CA5B (NM_007220) Human Untagged Clone

CAT#: SC310537

CA5B (untagged)-Human carbonic anhydrase VB, mitochondrial (CA5B), nuclear gene encoding mitochondrial protein


  "NM_007220" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CA5B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CA5B
Synonyms CA-VB; CAVB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_007220, the custom clone sequence may differ by one or more nucleotides


ATGGTGGTGATGAACAGCCTGAGGGTCATTCTTCAAGCCTCTCCAGGCAAATTGCTGTGGAGAAAGTTCC
AGATTCCGAGATTCATGCCAGCGAGGCCCTGCAGCCTCTATACTTGTACTTACAAAACCCGGAACCGAGC
CTTGCATCCACTCTGGGAGAGCGTGGACCTGGTTCCTGGGGGCGATCGCCAGTCACCCATCAACATTCGG
TGGAGGGACAGTGTTTATGATCCCGGCTTAAAACCACTGACCATCTCTTATGACCCAGCCACCTGCCTCC
ACGTCTGGAATAATGGGTACTCTTTCCTCGTGGAATTTGAAGATTCTACAGATAAATCAGTGATCAAGGG
AGGACCCCTGGAACACAACTACCGATTGAAGCAGTTCCATTTTCACTGGGGGGCCATCGATGCCTGGGGT
TCTGAGCACACCGTGGACAGCAAATGCTTCCCAGCAGAGCTGCACTTAGTGCATTGGAACGCAGTCAGAT
TTGAAAACTTTGAGGATGCAGCACTGGAAGAAAATGGTTTGGCTGTGATAGGAGTATTTTTAAAGCTAGG
CAAACATCATAAGGAGCTACAGAAATTAGTGGATACTTTGCCGTCAATTAAGCATAAGGACGCCCTTGTG
GAATTTGGGTCATTTGACCCTTCCTGCCTGATGCCTACCTGCCCAGATTACTGGACCTACTCAGGGTCTC
TGACTACCCCACCCCTCTCCGAGTCTGTCACCTGGATCATTAAGAAGCAACCAGTAGAGGTTGATCATGA
TCAGCTTGAGCAATTTCGGACCCTGCTTTTCACTTCCGAAGGGGAGAAAGAGAAAAGAATGGTGGACAAC
TTCCGCCCCCTTCAGCCACTGATGAATCGCACTGTTCGTTCATCCTTCCGGCATGATTATGTGCTGAATG
TACAAGCGAAACCCAAGCCGGCCACCAGCCAAGCAACCCCCTAA


Restriction Sites AscI-MluI     
ACCN NM_007220
ORF Size 954 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_007220.3, NP_009151.1
RefSeq Size 6032
RefSeq ORF 954
Locus ID 11238
Domains carb_anhydrase
Protein Families Druggable Genome
Protein Pathways Nitrogen metabolism
Gene Summary Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This gene encodes carbonic anhydrase 5B. CA5B, and the related CA5A gene, has its expression localized in the mitochondria though CA5B has a wider tissue distribution than CA5A, which is restricted to the liver, kidneys, and skeletal muscle. A carbonic anhydrase pseudogene (CA5BP1) is adjacent to the CA5B gene and these two loci produce CA5BP1-CA5B readthrough transcripts. [provided by RefSeq, Jan 2019]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.