SIRT5 (NM_031244) Human Untagged Clone

CAT#: SC310555

SIRT5 (untagged)-Human sirtuin 5 (SIRT5), transcript variant 2


  "NM_031244" in other vectors (4)

Reconstitution Protocol

SC310555 is the updated version of SC110309.

USD 660.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SIRT5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SIRT5
Synonyms SIR2L5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_031244 edited
ATGCGACCTCTCCAGATTGTCCCAAGTCGATTGATTTCCCAGCTATATTGTGGCCTGAAG
CCTCCAGCGTCCACACGAAACCAGATTTGCCTGAAAATGGCTCGGCCAAGTTCAAGTATG
GCAGATTTTCGAAAGTTTTTTGCAAAAGCAAAGCACATAGTCATCATCTCAGGAGCTGGT
GTTAGTGCAGAAAGTGGTGTTCCGACCTTCAGAGGAGCTGGAGGTTATTGGAGAAAATGG
CAAGCCCAGGACCTGGCGACTCCCCTGGCCTTTGCCCACAACCCGTCCCGGGTGTGGGAG
TTCTACCACTACCGGCGGGAGGTCATGGGGAGCAAGGAGCCCAACGCCGGGCACCGCGCC
ATAGCCGAGTGTGAGACCCGGCTGGGCAAGCAGGGCCGGCGAGTCGTGGTCATCACCCAG
AACATCGATGAGCTGCACCGCAAGGCTGGCACCAAGAACCTTCTGGAGATCCATGGTAGC
TTATTTAAAACTCGATGTACCTCTTGTGGAGTTGTGGCTGAGAATTACAAGAGTCCAATT
TGTCCAGCTTTATCAGGAAAAGGTGCTCCAGAACCTGGAACTCAAGATGCCAGCATCCCA
GTTGAGAAACTTCCCCGGTGTGAAGAGGCAGGCTGCGGGGGCTTGCTGCGACCTCATGTC
GTGTGGTTTGGAGAAAACCTGGATCCTGCCATTCTGGAGGAGGTTGACAGAGAGCTCGCC
CACTGTGATTTATGTCTAGTGGTGGGCACTTCCTCTGTGGTGTACCCAGCAGCCATGTTT
GCCCCCCAGGTGGCTGCCAGGGGCGTGCCAGTGGCTGAATTTAACACGGAGACCACCCCA
GCTACGAACAGATTCAGTCATTTGATCTCCATCTCATCTCTAATTATTATAAAGAATTAA
Restriction Sites Please inquire     
ACCN NM_031244
ORF Size 900 bp
Insert Size 900
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_031244.1.
Reference Data
RefSeq NM_031244.1, NP_112534.1
RefSeq Size 2350
RefSeq ORF 900
Locus ID 23408
Domains SIR2
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class III of the sirtuin family. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2010]
Transcript Variant: This variant (2) contains a distinct 5' UTR, C-terminal coding region, and 3' UTR as compared to transcript variant 1. This variant encodes isoform 2 which has a distinct and shorter C-terminus than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.