SIRT5 (NM_031244) Human Untagged Clone
CAT#: SC310555
SIRT5 (untagged)-Human sirtuin 5 (SIRT5), transcript variant 2
"NM_031244" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SIRT5 |
Synonyms | SIR2L5 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_031244 edited
ATGCGACCTCTCCAGATTGTCCCAAGTCGATTGATTTCCCAGCTATATTGTGGCCTGAAG CCTCCAGCGTCCACACGAAACCAGATTTGCCTGAAAATGGCTCGGCCAAGTTCAAGTATG GCAGATTTTCGAAAGTTTTTTGCAAAAGCAAAGCACATAGTCATCATCTCAGGAGCTGGT GTTAGTGCAGAAAGTGGTGTTCCGACCTTCAGAGGAGCTGGAGGTTATTGGAGAAAATGG CAAGCCCAGGACCTGGCGACTCCCCTGGCCTTTGCCCACAACCCGTCCCGGGTGTGGGAG TTCTACCACTACCGGCGGGAGGTCATGGGGAGCAAGGAGCCCAACGCCGGGCACCGCGCC ATAGCCGAGTGTGAGACCCGGCTGGGCAAGCAGGGCCGGCGAGTCGTGGTCATCACCCAG AACATCGATGAGCTGCACCGCAAGGCTGGCACCAAGAACCTTCTGGAGATCCATGGTAGC TTATTTAAAACTCGATGTACCTCTTGTGGAGTTGTGGCTGAGAATTACAAGAGTCCAATT TGTCCAGCTTTATCAGGAAAAGGTGCTCCAGAACCTGGAACTCAAGATGCCAGCATCCCA GTTGAGAAACTTCCCCGGTGTGAAGAGGCAGGCTGCGGGGGCTTGCTGCGACCTCATGTC GTGTGGTTTGGAGAAAACCTGGATCCTGCCATTCTGGAGGAGGTTGACAGAGAGCTCGCC CACTGTGATTTATGTCTAGTGGTGGGCACTTCCTCTGTGGTGTACCCAGCAGCCATGTTT GCCCCCCAGGTGGCTGCCAGGGGCGTGCCAGTGGCTGAATTTAACACGGAGACCACCCCA GCTACGAACAGATTCAGTCATTTGATCTCCATCTCATCTCTAATTATTATAAAGAATTAA |
Restriction Sites | Please inquire |
ACCN | NM_031244 |
ORF Size | 900 bp |
Insert Size | 900 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_031244.1. |
Reference Data | |
RefSeq | NM_031244.1, NP_112534.1 |
RefSeq Size | 2350 |
RefSeq ORF | 900 |
Locus ID | 23408 |
Domains | SIR2 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class III of the sirtuin family. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2010] Transcript Variant: This variant (2) contains a distinct 5' UTR, C-terminal coding region, and 3' UTR as compared to transcript variant 1. This variant encodes isoform 2 which has a distinct and shorter C-terminus than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221409 | SIRT5 (Myc-DDK-tagged)-Human sirtuin 5 (SIRT5), transcript variant 2 |
USD 420.00 |
|
RG221409 | SIRT5 (GFP-tagged) - Human sirtuin 5 (SIRT5), transcript variant 2 |
USD 460.00 |
|
RC221409L3 | Lenti ORF clone of Human sirtuin 5 (SIRT5), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC221409L4 | Lenti ORF clone of Human sirtuin 5 (SIRT5), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review