KCNIP4 (NM_147181) Human Untagged Clone
CAT#: SC310621
KCNIP4 (untagged)-Human Kv channel interacting protein 4 (KCNIP4), transcript variant 2
"NM_147181" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCNIP4 |
Synonyms | CALP; KCHIP4 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_147181, the custom clone sequence may differ by one or more nucleotides
ATGAATGTGAGGAGGGTGGAAAGCATTTCGGCTCAGCTGGAGGAGGCCAGCTCTACAGGC GACAGCGTGGAAGATGAACTGGAGATGGCCACCGTCAGGCATCGGCCTGAAGCCCTTGAG CTTCTGGAAGCCCAGAGCAAATTTACCAAGAAAGAGCTTCAGATCCTTTACAGAGGATTT AAGAATGAATGCCCCAGTGGTGTTGTTAATGAAGAAACCTTCAAAGAGATTTACTCGCAG TTCTTTCCACAGGGAGACTCTACAACATATGCACATTTTCTGTTCAATGCATTTGATACA GACCACAATGGAGCTGTGAGTTTCGAGGATTTCATCAAAGGTCTTTCCATTTTGCTCCGG GGGACAGTACAAGAAAAACTCAATTGGGCATTTAATCTGTATGACATAAATAAAGATGGC TACATCACTAAAGAGGAAATGCTTGATATAATGAAAGCAATATACGATATGATGGGTAAA TGTACATATCCTGTCCTCAAAGAAGATGCTCCCAGACAACACGTTGAAACATTTTTTCAG AAAATGGACAAAAATAAAGATGGGGTTGTTACCATAGATGAGTTCATTGAAAGCTGCCAA AAAGATGAAAACATAATGCGCTCCATGCAGCTCTTTGAAAATGTGATTTAA |
Restriction Sites | Please inquire |
ACCN | NM_147181 |
ORF Size | 651 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_147181.3, NP_671710.1 |
RefSeq Size | 2259 |
RefSeq ORF | 651 |
Locus ID | 80333 |
Protein Families | Druggable Genome, Ion Channels: Other |
Gene Summary | This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the recoverin branch of the EF-hand superfamily. Members of the KCNIP family are small calcium binding proteins. They all have EF-hand-like domains, and differ from each other in the N-terminus. They are integral subunit components of native Kv4 channel complexes. They may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. This protein member also interacts with presenilin. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, as compared to variant 1. Isoform 2, also known as KCHIP4.2, is thus missing an internal segment, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211542 | KCNIP4 (Myc-DDK-tagged)-Human Kv channel interacting protein 4 (KCNIP4), transcript variant 2 |
USD 420.00 |
|
RG211542 | KCNIP4 (GFP-tagged) - Human Kv channel interacting protein 4 (KCNIP4), transcript variant 2 |
USD 460.00 |
|
RC211542L3 | Lenti-ORF clone of KCNIP4 (Myc-DDK-tagged)-Human Kv channel interacting protein 4 (KCNIP4), transcript variant 2 |
USD 620.00 |
|
RC211542L4 | Lenti-ORF clone of KCNIP4 (mGFP-tagged)-Human Kv channel interacting protein 4 (KCNIP4), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review