IMMP1L (NM_144981) Human Untagged Clone

CAT#: SC310652

IMMP1L (untagged)-Human IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP1L), nuclear gene encoding mitochondrial protein

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IMMP1L
• Synonyms: IMMP1; IMP1; IMP1-LIKE
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_144981, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTTCGTGGTGTTCTGGGGAAAACCTTTCGACTTGTTGGCTATACTATTCAATATGGCTGTATAGCTC
  ATTGTGCTTTTGAATACGTTGGTGGTGTTGTCATGTGTTCTGGACCATCAATGGAGCCTACAATTCAAAA
  TTCAGATATTGTCTTTGCAGAAAATCTTAGTCGACATTTTTATGGTATCCAAAGAGGTGACATTGTGATT
  GCAAAAAGCCCAAGTGATCCAAAATCAAATATTTGTAAAAGAGTAATTGGTTTGGAAGGAGACAAAATCC
  TCACCACTAGTCCATCAGATTTCTTTAAAAGCCATAGTTATGTGCCAATGGGTCATGTTTGGTTAGAAGG
  TGACAATCTACAGAATTCTACAGATTCCAGGTGCTATGGACCTATTCCATATGGACTAATAAGAGGACGA
  ATCTTCTTTAAGATTTGGCCTCTGAGTGATTTTGGATTTTTACGTGCCAGCCCTAATGGCCACAGATTTT
  CTGATGATTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_144981
• ORF Size: 501 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_144981.2, NP_659418.1
• RefSeq Size: 821
• RefSeq ORF: 501
• Locus ID: 196294
• Domains: Peptidase_S26
• Protein Families: Protease
• Gene Summary: The mitochondrial inner membrane peptidase (IMP) complex generates mature, active proteins in the mitochondrial intermembrane space by proteolytically removing the mitochondrial targeting presequence of nuclear-encoded proteins. IMP1 and IMP2 (IMMP2L; MIM 605977) are the catalytic subunits of the IMP complex (Burri et al., 2005 [PubMed 15814844]). [supplied by OMIM, Sep 2008]
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.