CREM (NM_001881) Human Untagged Clone
CAT#: SC310675
CREM (untagged)-Human cAMP responsive element modulator (CREM), transcript variant 2
"NM_001881" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CREM |
Synonyms | CREM-2; hCREM-2; ICER |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001881, the custom clone sequence may differ by one or more nucleotides
ATGACCATGGAAACAGTTGAATCCCAGCATGATGGAAGTATAACAGCTTCTTTGACAGAG AGCAAGTCTGCTCATGTGCAGACTCAGACTGGCCAAAATTCAATCCCTGCTTTAGCTCAG GTAGCAGCAATTGCAGAGACAGATGAATCTGCAGAATCAGAAGGTGTAATTGATTCTCAT AAACGTAGAGAAATCCTTTCACGAAGACCCTCTTATAGGAAAATACTGAATGAACTGTCC TCTGATGTGCCTGGTGTTCCCAAGATTGAAGAAGAGAGATCAGAGGAAGAAGGAACACCA CCTAGTATTGCTACCATGGCAGTACCAACTAGCATATATCAGACTAGCACGGGGCAATAC AGTATGTATGCTGCAATTCGATATGATACAGTGCTAGCTTTAAGTCTTCTCTAG |
Restriction Sites | Please inquire |
ACCN | NM_001881 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001881.2, NP_001872.3 |
RefSeq Size | 1308 bp |
RefSeq ORF | 414 bp |
Locus ID | 1390 |
Cytogenetics | 10p11.21 |
Domains | pKID, BRLZ |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | 'This gene encodes a bZIP transcription factor that binds to the cAMP responsive element found in many viral and cellular promoters. It is an important component of cAMP-mediated signal transduction during the spermatogenetic cycle, as well as other complex processes. Alternative promoter and translation initiation site usage allows this gene to exert spatial and temporal specificity to cAMP responsiveness. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene, with some of them functioning as activators and some as repressors of transcription. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (2) differs in the 5' UTR, 3' UTR, and coding region, compared to variant 1. These differences cause translation initiation at a downstream ATG, and result in a shorter isoform (2, also known as b) with a shorter N-terminus and a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215948 | CREM (Myc-DDK-tagged)-Human cAMP responsive element modulator (CREM), transcript variant 2 |
USD 420.00 |
|
RG215948 | CREM (GFP-tagged) - Human cAMP responsive element modulator (CREM), transcript variant 2 |
USD 460.00 |
|
RC215948L3 | Lenti-ORF clone of CREM (Myc-DDK-tagged)-Human cAMP responsive element modulator (CREM), transcript variant 2 |
USD 620.00 |
|
RC215948L4 | Lenti-ORF clone of CREM (mGFP-tagged)-Human cAMP responsive element modulator (CREM), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review