PP4R4 (PPP4R4) (NM_020958) Human Untagged Clone

CAT#: SC310683

PPP4R4 (untagged)-Human protein phosphatase 4, regulatory subunit 4 (PPP4R4), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPP4R4
• Synonyms: CFAP14; KIAA1622; PP4R4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_020958, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCATCCGCCGCCGCCCGCCGCCGCGATGGATTTCAGTCAGAACAGCCTGTTCGGTTACATGGAGGACC
  TGCAGGAGCTCACCATCATCGAGAGGCCGGTCCGCCGGAGCCTCAAGACACCGGAAGAAATAGAAAGATT
  GACAGTCGATGAAGACCTCAGTGATATTGAAAGGGCTGTTTATCTGCTCAGTGCTGGTCAAGATGTCCAA
  GGAACAAGTGTGATTGCAAATCTCCCATTTTTGATGCGACAGAATCCCACTGAGACGCTTCGGAGAGTGT
  TGCCAAAAGTCAGAGTCCATGAGGATGCACACTTATTTATCCAGAGAGTATGGATCTCACATATGTTTGT
  CCAGAGGGTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_020958
• ORF Size: 363 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_020958.2, NP_066009.2
• RefSeq Size: 923
• RefSeq ORF: 363
• Locus ID: 57718
• Protein Families: Phosphatase
• Gene Summary: The protein encoded by this gene is a HEAT-like repeat-containing protein. The HEAT repeat is a tandemly repeated, 37-47 amino acid long module occurring in a number of cytoplasmic proteins. Arrays of HEAT repeats form a rod-like helical structure and appear to function as protein-protein interaction surfaces. The repeat-containing region of this protein has some similarity to the constant regulatory domain of the protein phosphatase 2A PR65/A subunit. The encoded protein binds protein serine/threonine phosphatase 4c in the cytoplasm. [provided by RefSeq, Jan 2017]
  Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1, resulting in a shorter isoform (2) that has a distinct C-terminus lacking HEAT-like repeats.