PP4R4 (PPP4R4) (NM_020958) Human Untagged Clone
CAT#: SC310683
PPP4R4 (untagged)-Human protein phosphatase 4, regulatory subunit 4 (PPP4R4), transcript variant 2
"NM_020958" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PPP4R4 |
Synonyms | CFAP14; KIAA1622; PP4R4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_020958, the custom clone sequence may differ by one or more nucleotides
ATGCATCCGCCGCCGCCCGCCGCCGCGATGGATTTCAGTCAGAACAGCCTGTTCGGTTACATGGAGGACC TGCAGGAGCTCACCATCATCGAGAGGCCGGTCCGCCGGAGCCTCAAGACACCGGAAGAAATAGAAAGATT GACAGTCGATGAAGACCTCAGTGATATTGAAAGGGCTGTTTATCTGCTCAGTGCTGGTCAAGATGTCCAA GGAACAAGTGTGATTGCAAATCTCCCATTTTTGATGCGACAGAATCCCACTGAGACGCTTCGGAGAGTGT TGCCAAAAGTCAGAGTCCATGAGGATGCACACTTATTTATCCAGAGAGTATGGATCTCACATATGTTTGT CCAGAGGGTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_020958 |
ORF Size | 363 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_020958.2, NP_066009.2 |
RefSeq Size | 923 |
RefSeq ORF | 363 |
Locus ID | 57718 |
Protein Families | Phosphatase |
Gene Summary | The protein encoded by this gene is a HEAT-like repeat-containing protein. The HEAT repeat is a tandemly repeated, 37-47 amino acid long module occurring in a number of cytoplasmic proteins. Arrays of HEAT repeats form a rod-like helical structure and appear to function as protein-protein interaction surfaces. The repeat-containing region of this protein has some similarity to the constant regulatory domain of the protein phosphatase 2A PR65/A subunit. The encoded protein binds protein serine/threonine phosphatase 4c in the cytoplasm. [provided by RefSeq, Jan 2017] Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1, resulting in a shorter isoform (2) that has a distinct C-terminus lacking HEAT-like repeats. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212907 | PPP4R4 (Myc-DDK-tagged)-Human protein phosphatase 4, regulatory subunit 4 (PPP4R4), transcript variant 2 |
USD 98.00 |
|
RG212907 | PPP4R4 (GFP-tagged) - Human protein phosphatase 4, regulatory subunit 4 (PPP4R4), transcript variant 2 |
USD 460.00 |
|
RC212907L3 | Lenti ORF clone of Human protein phosphatase 4, regulatory subunit 4 (PPP4R4), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC212907L4 | Lenti ORF clone of Human protein phosphatase 4, regulatory subunit 4 (PPP4R4), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review