DR3 (TNFRSF25) (NM_001039664) Human Untagged Clone

CAT#: SC310758

TNFRSF25 (untagged)-Human tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), transcript variant 12

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TNFRSF25
• Synonyms: APO-3; DDR3; DR3; GEF720; LARD; PLEKHG5; TNFRSF12; TR3; TRAMP; WSL-1; WSL-LR
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001039664, the custom clone sequence may differ by one or more nucleotides
  ATGGAGCAGCGGCCGCGGGGCTGCGCGGCGGTGGCGGCGGCGCTCCTCCTGGTGCTGCTG
  GGGGCCCGGGCCCAGGGCGGCACTCGTAGCCCCAGGTGTGACTGTGCCGGTGACTTCCAC
  AAGAAGATTGGTCTGTTTTGTTGCAGAGGCTGCCCAGCGGGGCACTACCTGAAGGCCCCT
  TGCACGGAGCCCTGCGGCAACTCCACCTGCCTTGTGTGTCCCCAAGACACCTTCTTGGCC
  TGGGAGAACCACCATAATTCTGAATGTGCCCGCTGCCAGGCCTGTGATGAGCAGGCCTCC
  CAGGTGGCGCTGGAGAACTGTTCAGCAGTGGCCGACACCCGCTGTGGCTGTAAGCCAGGC
  TGGTTTGTGGAGTGCCAGGTCAGCCAATGTGTCAGCAGTTCACCCTTCTACTGCCAACCA
  TGCCTAGACTGCGGGGCCCTGCACCGCCACACACGGCTACTCTGTTCCCGCAGAGATACT
  GACTGTGGGACCTGCCTGCCTGGCTTCTATGAACATGGCGATGGCTGCGTGTCCTGCCCC
  ACGTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001039664
• ORF Size: 546 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001039664.1, NP_001034753.1
• RefSeq Size: 894
• RefSeq ORF: 546
• Locus ID: 8718
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction
• Gene Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed preferentially in the tissues enriched in lymphocytes, and it may play a role in regulating lymphocyte homeostasis. This receptor has been shown to stimulate NF-kappa B activity and regulate cell apoptosis. The signal transduction of this receptor is mediated by various death domain containing adaptor proteins. Knockout studies in mice suggested the role of this gene in the removal of self-reactive T cells in the thymus. Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported, most of which are potentially secreted molecules. The alternative splicing of this gene in B and T cells encounters a programmed change upon T-cell activation, which predominantly produces full-length, membrane bound isoforms, and is thought to be involved in controlling lymphocyte proliferation induced by T-cell activation. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (12) lacks several 3' exons and has an alternate 3' end, when compared to variant 1. The resulting isoform (12) has a distinct and shorter C-terminus, as compared to isoform 1.