CHTF8 (NM_001039690) Human Untagged Clone
CAT#: SC310815
CHTF8 (untagged)-Human CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae) (CHTF8), transcript variant 1
"NM_001039690" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CHTF8 |
Synonyms | CTF8; DERPC |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001039690, the custom clone sequence may differ by one or more nucleotides
ATGGTGCAAATTGTTATTTCCAGTGCGAGGGCTGGAGGCCTGGCAGAATGGGTGCTGATGGAGCTACAGG GGGAGATCGAGGCTCGCTACAGCACTGGATTAGCTGGAAACCTCCTGGGAGACCTACATTACACCACTGA GGGAATCCCTGTGCTGATCGTGGGGCATCATATCCTGTATGGGAAAATCATCCACCTGGAGAAACCTTTT GCAGTCCTTGTCAAACACACTCCTGGGGATCAGGACTGTGATGAGCTTGGCCGCGAGACTGGCACCCGGT ACCTGGTGACAGCACTCATCAAAGACAAGATCCTTTTCAAAACCCGCCCCAAGCCCATTATCACCAGCGT CCCCAAGAAAGTATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001039690 |
ORF Size | 366 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001039690.3, NP_001034779.1 |
RefSeq Size | 2934 |
RefSeq ORF | 366 |
Locus ID | 54921 |
Gene Summary | This gene encodes a short protein that forms part of the Ctf18 replication factor C (RFC) complex that occurs in both yeast and mammals. The heteroheptameric RFC complex plays a role in sister chromatid cohesion and may load the replication clamp PCNA (proliferating cell nuclear antigen) onto DNA during DNA replication and repair. This gene is ubiquitously expressed and has been shown to have reduced expression in renal and prostate tumors. Alternatively spliced transcript variants have been described. This gene has a pseudogene on chromosome X. [provided by RefSeq, Oct 2018] Transcript Variant: This variant (1) represents the longer transcript. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222566 | CHTF8 (Myc-DDK-tagged)-Human CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae) (CHTF8), transcript variant 1 |
USD 420.00 |
|
RG222566 | CHTF8 (GFP-tagged) - Human CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae) (CHTF8), transcript variant 1 |
USD 460.00 |
|
RC222566L3 | Lenti ORF clone of Human CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae) (CHTF8), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC222566L4 | Lenti ORF clone of Human CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae) (CHTF8), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review