CHTF8 (NM_001039690) Human Untagged Clone

CAT#: SC310815

CHTF8 (untagged)-Human CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae) (CHTF8), transcript variant 1


  "NM_001039690" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CHTF8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CHTF8
Synonyms CTF8; DERPC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001039690, the custom clone sequence may differ by one or more nucleotides


ATGGTGCAAATTGTTATTTCCAGTGCGAGGGCTGGAGGCCTGGCAGAATGGGTGCTGATGGAGCTACAGG
GGGAGATCGAGGCTCGCTACAGCACTGGATTAGCTGGAAACCTCCTGGGAGACCTACATTACACCACTGA
GGGAATCCCTGTGCTGATCGTGGGGCATCATATCCTGTATGGGAAAATCATCCACCTGGAGAAACCTTTT
GCAGTCCTTGTCAAACACACTCCTGGGGATCAGGACTGTGATGAGCTTGGCCGCGAGACTGGCACCCGGT
ACCTGGTGACAGCACTCATCAAAGACAAGATCCTTTTCAAAACCCGCCCCAAGCCCATTATCACCAGCGT
CCCCAAGAAAGTATGA


Restriction Sites SgfI-MluI     
ACCN NM_001039690
ORF Size 366 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001039690.3, NP_001034779.1
RefSeq Size 2934
RefSeq ORF 366
Locus ID 54921
Gene Summary This gene encodes a short protein that forms part of the Ctf18 replication factor C (RFC) complex that occurs in both yeast and mammals. The heteroheptameric RFC complex plays a role in sister chromatid cohesion and may load the replication clamp PCNA (proliferating cell nuclear antigen) onto DNA during DNA replication and repair. This gene is ubiquitously expressed and has been shown to have reduced expression in renal and prostate tumors. Alternatively spliced transcript variants have been described. This gene has a pseudogene on chromosome X. [provided by RefSeq, Oct 2018]
Transcript Variant: This variant (1) represents the longer transcript. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.