CHTF8 (NM_001040146) Human Untagged Clone

CAT#: SC310934

CHTF8 (untagged)-Human CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae) (CHTF8), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CHTF8
• Synonyms: CTF8; DERPC
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001040146, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGCAAATTGTTATTTCCAGTGCGAGGGCTGGAGGCCTGGCAGAATGGGTGCTGATGGAGCTACAGG
  GGGAGATCGAGGCTCGCTACAGCACTGGATTAGCTGGAAACCTCCTGGGAGACCTACATTACACCACTGA
  GGGAATCCCTGTGCTGATCGTGGGGCATCATATCCTGTATGGGAAAATCATCCACCTGGAGAAACCTTTT
  GCAGTCCTTGTCAAACACACTCCTGGGGATCAGGACTGTGATGAGCTTGGCCGCGAGACTGGCACCCGGT
  ACCTGGTGACAGCACTCATCAAAGACAAGATCCTTTTCAAAACCCGCCCCAAGCCCATTATCACCAGCGT
  CCCCAAGAAAGTATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001040146
• ORF Size: 366 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001040146.3, NP_001035236.1
• RefSeq Size: 2907
• RefSeq ORF: 366
• Locus ID: 54921
• Gene Summary: This gene encodes a short protein that forms part of the Ctf18 replication factor C (RFC) complex that occurs in both yeast and mammals. The heteroheptameric RFC complex plays a role in sister chromatid cohesion and may load the replication clamp PCNA (proliferating cell nuclear antigen) onto DNA during DNA replication and repair. This gene is ubiquitously expressed and has been shown to have reduced expression in renal and prostate tumors. Alternatively spliced transcript variants have been described. This gene has a pseudogene on chromosome X. [provided by RefSeq, Oct 2018]
  Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Both variants 1 and 4 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.