AGTRAP (NM_001040194) Human Untagged Clone

CAT#: SC310965

AGTRAP (untagged)-Human angiotensin II receptor-associated protein (AGTRAP), transcript variant 2


  "NM_001040194" in other vectors (7)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "AGTRAP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AGTRAP
Synonyms ATRAP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001040194, the custom clone sequence may differ by one or more nucleotides


ATGGAGCTGCCTGCTGTGAACCTGAAGGTGATTCTCCTAGGTCACTGGCTGCTGACAACCTGGGGCTGCA
TTGTATTCTCAGGCTCCTATGCCTGGGCCAACTTCACCATCCTGGCCTTGGGCGTGTGGGCTGTGGCTCA
GCGGGACTCCATCGACGCCATAAGCATGTTTCTGGGTGGCTTGCTGGCCACCATCTTCCTGGACATCGTG
CACATCAGCATCTTCTACCCGCGGGTCAGCCTCACGGACACGGGCCGCTTTGGCGTGGGCATGGCCATCC
TCAGCTTGCTGCTCAAGCCGCTCTCCTGCTGCTTCGTCTACCACATGTACCGGGAGCGCGGGGGTTTCCT
TGGGTCTTCTCAGGACCGTAGTGCCTACCAGACGATTGACTCAGCAGAGGCGCCCGCAGATCCCTTTGCA
GTCCCAGAGGGCAGGAGTCAAGATGCCCGAGGGTACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001040194
ORF Size 459 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001040194.1, NP_001035284.1
RefSeq Size 1179
RefSeq ORF 459
Locus ID 57085
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a transmembrane protein localized to the plasma membrane and perinuclear vesicular structures. The gene product interacts with the angiotensin II type I receptor and negatively regulates angiotensin II signaling. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.