AGTRAP (NM_001040195) Human Untagged Clone
CAT#: SC310966
AGTRAP (untagged)-Human angiotensin II receptor-associated protein (AGTRAP), transcript variant 3
"NM_001040195" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AGTRAP |
Synonyms | ATRAP |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001040195, the custom clone sequence may differ by one or more nucleotides
ATGGAGCTGCCTGCTGTGAACCTGAAGGGGCTGCATTGTATTCTCAGGCTCCTATGCCTG GGCCAACTTCACCATCCTGGCCTTGGGCGTGTGGGCTGTGGCTCAGCGGGACTCCATCGA CGCCATAAGCATGTTTCTGGGTGGCTTGCTGGCCACCATCTTCCTGGACATCGTGCACAT CAGCATCTTCTACCCGCGGGTCAGCCTCACGGACACGGGCCGCTTTGGCGTGGGCATGGC CATCCTCAGCTTGCTGCTCAAGCCGCTCTCCTGCTGCTTCGTCTACCACATGTACCGGGA GCGCGGGGGTTTCCTTGGGTCTTCTCAGGACCGTAG |
Restriction Sites | Please inquire |
ACCN | NM_001040195 |
ORF Size | 336 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001040195.1, NP_001035285.1 |
RefSeq Size | 1144 |
RefSeq ORF | 336 |
Locus ID | 57085 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a transmembrane protein localized to the plasma membrane and perinuclear vesicular structures. The gene product interacts with the angiotensin II type I receptor and negatively regulates angiotensin II signaling. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks an exon and uses an alternate splice site for a second exon in the 3' coding region, compared to variant 1, resulting in a frameshift. The resulting protein (isoform c) has a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223005 | AGTRAP (Myc-DDK-tagged)-Human angiotensin II receptor-associated protein (AGTRAP), transcript variant 3 |
USD 420.00 |
|
RG223005 | AGTRAP (GFP-tagged) - Human angiotensin II receptor-associated protein (AGTRAP), transcript variant 3 |
USD 460.00 |
|
RC223005L3 | Lenti-ORF clone of AGTRAP (Myc-DDK-tagged)-Human angiotensin II receptor-associated protein (AGTRAP), transcript variant 3 |
USD 620.00 |
|
RC223005L4 | Lenti-ORF clone of AGTRAP (mGFP-tagged)-Human angiotensin II receptor-associated protein (AGTRAP), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review