AGTRAP (NM_001040195) Human Untagged Clone

CAT#: SC310966

AGTRAP (untagged)-Human angiotensin II receptor-associated protein (AGTRAP), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AGTRAP
• Synonyms: ATRAP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001040195, the custom clone sequence may differ by one or more nucleotides
  ATGGAGCTGCCTGCTGTGAACCTGAAGGGGCTGCATTGTATTCTCAGGCTCCTATGCCTG
  GGCCAACTTCACCATCCTGGCCTTGGGCGTGTGGGCTGTGGCTCAGCGGGACTCCATCGA
  CGCCATAAGCATGTTTCTGGGTGGCTTGCTGGCCACCATCTTCCTGGACATCGTGCACAT
  CAGCATCTTCTACCCGCGGGTCAGCCTCACGGACACGGGCCGCTTTGGCGTGGGCATGGC
  CATCCTCAGCTTGCTGCTCAAGCCGCTCTCCTGCTGCTTCGTCTACCACATGTACCGGGA
  GCGCGGGGGTTTCCTTGGGTCTTCTCAGGACCGTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001040195
• ORF Size: 336 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001040195.1, NP_001035285.1
• RefSeq Size: 1144
• RefSeq ORF: 336
• Locus ID: 57085
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a transmembrane protein localized to the plasma membrane and perinuclear vesicular structures. The gene product interacts with the angiotensin II type I receptor and negatively regulates angiotensin II signaling. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) lacks an exon and uses an alternate splice site for a second exon in the 3' coding region, compared to variant 1, resulting in a frameshift. The resulting protein (isoform c) has a distinct C-terminus compared to isoform a.