C19orf46 (SYNE4) (NM_001039876) Human Untagged Clone

CAT#: SC311016

SYNE4 (untagged)-Human chromosome 19 open reading frame 46 (C19orf46)


  "NM_001039876" in other vectors (4)

Reconstitution Protocol

USD 690.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SYNE4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SYNE4
Synonyms C19orf46; DFNB76; KASH4; Nesp4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001039876, the custom clone sequence may differ by one or more nucleotides


ATGGCCCTGTCCCTGCCTCTGGGCCCTAGACTTGGCTCAGAGCCCCTCAACCACCCACCGGGAGCACCTA
GAGAGGCGGACATTGTTGGATGCACCGTCTGCCCCGCGTCCGGAGAGGAGAGCACGAGCCCAGAGCAGGC
CCAGACCCTGGGACAGGACTCCTTGGGCCCTCCTGAGCACTTCCAGGGTGGGCCAAGGGGCAATGAGCCT
GCCGCTCACCCCCCGAGATGGTCAACACCCTCTTCCTACGAGGACCCAGCTGGGGGCAAACACTGTGAGC
ACCCCATTTCTGGCCTGGAGGTACTAGAGGCTGAGCAGAACAGCCTGCACCTGTGCCTGCTGGGGCTGGG
CCGCCGGCTGCAGGACCTGGAGCAAGGCCTGGGGCACTGGGCATTGGCCCAGAGTGGGATGGTGCAGCTG
CAGGCCCTCCAGGTGGACCTACGAGGGGCAGCTGAGCGTGTGGAGGCGCTGCTAGCGTTTGGTGAGGGGC
TGGCACAGCGGAGTGAGCCCAGGGCCTGGGCAGCCCTGGAGCAGATCCTGCGGGCCCTGGGAGCTTACCG
AGACTCCATCTTCCGGCGGCTCTGGCAGCTGCAGGCCCAGCTGGTCAGCTACAGCCTGGTGTTCGAGGAG
GCCAACACGCTGGACCAGGACTTGGAGGTCGAGGGAGACTCGGACTGGCCAGGACCTGGTGGGGTCTGGG
GGCCCTGGGCACCCAGTAGCCTCCCCACTTCCACAGAGTTGGAGTGGGATCCGGCGGGGGACATTGGGGG
CCTTGGGCCCTTGGGACAAAAGACAGCCCGGACACTAGGAGTGCCCTGTGAGCTGTGTGGCCAGAGGGGG
CCCCAGGGCAGGGGACAAGGCCTTGAGGAAGCAGACACCTCTCACTCCCGACAGGACATGCTGGAGTCTG
GCCTCGGCCACCAGAAACGCTTAGCACGTCACCAAAGACACTCCCTGCTCCGGAAGCCTCAGGACAAGAA
GAGGCAAGCATCTCCTCATCTCCAGGATGTGAGGCTGGAGGGGAATCCAGGGGCCCCCGATCCTGCATCC
AGGCAGCCTCTGACCTTCCTCCTTATCCTCTTCCTCCTCTTCCTCCTCCTGGTGGGTGCCATGTTTCTCC
TGCCCGCGTCAGGAGGCCCCTGCTGCTCTCATGCCCGAATACCCAGGACACCCTACCTGGTGCTCAGCTA
TGTCAATGGTCTTCCCCCAGTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001039876
ORF Size 1215 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001039876.2, NP_001034965.1
RefSeq Size 1375
RefSeq ORF 1215
Locus ID 163183
Protein Families Transmembrane
Gene Summary This gene is a member of the nesprin family of genes, that encode KASH (Klarsicht, Anc-1, Syne Homology) domain-containing proteins. In addition to the KASH domain, this protein also contains a coiled-coil and leucine zipper region, a spectrin repeat, and a kinesin-1 binding region. This protein localizes to the outer nuclear membrane, and is part of the linker of nucleoskeleton and cytoskeleton (LINC) complex in the nuclear envelope. LINC complexes are formed by SUN (Sad1, UNC-84)-KASH pairs, and are thought to mechanically couple nuclear components to the cytoskeleton. Mutations in this gene have been associated with progressive high-frequency hearing loss. The absence of this protein in mice also caused hearing loss, and changes in hair cell morphology in the ears. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.