Chimaerin 2 (CHN2) (NM_001039936) Human Untagged Clone

CAT#: SC311097

CHN2 (untagged)-Human chimerin (chimaerin) 2 (CHN2), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CHN2
• Synonyms: ARHGAP3; BCH; CHN2-3; RHOGAP3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001039936, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTCTCTGAAGAACTGTGGCTGGAAAATGAGAAAAAGTGTGCTGTGGTTCGGAAGTCTAAGCAGGGCA
  GGAAACGCCAAGAACTGCTGGCCGTAGCCTTCGGGGTGAAGGTGGGTGTCAAAGGCGGCTTTCTTTGGCC
  CCCTCTCAAACTCTTTGCCTGTTCACAGATCTCCTCCCTGGTTCGAAGGGCTGCCCTCACACACAACGAC
  AACCACTTCAATTATGAGAAGACACACAACTTTAAGGTCCACACGTTCCGAGGCCCACACTGGTGTGAAT
  ATTGTGCCAATTTCATGTGGGGGCTCATCGCCCAAGGGGTCCGGTGCTCAGACTGTGGATTGAACGTACA
  CAAACAGTGTTCCAAGCACGTTCCCAATGACTGCCAACCTGATCTCAAGAGGATCAAGAAAGTGTACTGT
  TGTGACCTCACAACACTTGTGAAGGCTCACAACACTCAGAGACCCATGGTGGTAGACATATGCATTCGGG
  AAATTGAAGCAAGAGGATTAAAATCGGAAGGCCTTTACAGAGTCTCTGGGTTCACTGAACACATTGAAGA
  TGTCAAAATGGCATTTGACAGAGATGGTGAAAAGGCCGATATATCTGCCAATGTCTATCCAGACATAAAC
  ATCATCACTGGAGCCCTTAAACTGTATTTCAGAGACTTACCCATCCCTGTCATCACATATGATACCTATT
  CCAAATTTATAGATGCAGCAAAAATCTCCAATGCAGATGAGAGGCTGGAAGCCGTCCATGAAGTGCTGAT
  GCTGCTGCCTCCTGCCCACTATGAAACCCTCCGGTACCTAATGATCCACCTCAAAAAGGTTACTATGAAT
  GAAAAAGACAATTTCATGAATGCAGAAAATCTGGGGATCGTGTTTGGGCCCACTCTGATGAGGCCCCCTG
  AGGACAGCACCCTGACCACCCTGCATGATATGCGGTACCAAAAGCTGATTGTGCAGATTTTAATAGAAAA
  CGAAGACGTTTTATTCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001039936
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001039936.2, NP_001035025.1
• RefSeq Size: 3015 bp
• RefSeq ORF: 999 bp
• Locus ID: 1124
• Cytogenetics: 7p14.3
• Gene Summary: 'This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that contains a phorbol-ester/diacylglycerol (DAG)-type zinc finger, a Rho-GAP domain, and an SH2 domain. The encoded protein translocates from the cytosol to the Golgi apparatus membrane upon binding by diacylglycerol (DAG). Activity of this protein is important in cell proliferation and migration, and expression changes in this gene have been detected in cancers. A mutation in this gene has also been associated with schizophrenia in men. Alternative transcript splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, May 2014]'
  Transcript Variant: This variant (1) encodes isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.