UBE2E1 (NM_003341) Human Untagged Clone

CAT#: SC311117

UBE2E1 (untagged)-Human ubiquitin-conjugating enzyme E2E 1 (UBE2E1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UBE2E1
• Synonyms: UBCH6
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_003341, the custom clone sequence may differ by one or more nucleotides
  ATGTCGGATGACGATTCGAGGGCCAGCACCAGCTCCTCCTCATCTTCGTCTTCCAACCAG
  CAAACCGAGAAAGAAACAAACACCCCCAAGAAGAAGGAGAGTAAAGTCAGCATGAGCAAA
  AACTCCAAACTCCTCTCCACCAGCGCCAAGAGAATTCAGAAGGAGCTGGCGGACATCACT
  TTAGACCCTCCACCTAATTGCAGTGCTGGTCCCAAAGGCGATAACATCTATGAATGGAGA
  TCAACCATTCTAGGGCCTCCAGGATCCGTGTATGAGGGTGGTGTATTCTTTCTCGATATC
  ACTTTTACACCAGAATATCCCTTCAAGCCTCCAAAGGTTACATTTCGGACAAGAATCTAT
  CATTGTAATATTAACAGTCAAGGTGTTATTTGCTTGGACATATTGAAAGATAATTGGAGT
  CCAGCACTAACCATTTCTAAAGTCCTCCTTTCTATCTGCTCACTTCTTACAGACTGTAAT
  CCTGCCGACCCCTTGGTGGGAAGTATTGCCACTCAGTATATGACCAACAGAGCAGAACAT
  GACAGAATGGCCAGACAGTGGACCAAGAGATACGCTACATAA
  
• Restriction Sites: Please inquire
• ACCN: NM_003341
• ORF Size: 582 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_003341.3, NP_003332.1
• RefSeq Size: 1479
• RefSeq ORF: 582
• Locus ID: 7324
• Domains: UBCc
• Protein Pathways: Ubiquitin mediated proteolysis
• Gene Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
  Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.