Ikaros (IKZF1) (NM_006060) Human Untagged Clone

CAT#: SC311120

IKZF1 (untagged)-Human IKAROS family zinc finger 1 (Ikaros) (IKZF1), transcript variant 1


  "NM_006060" in other vectors (6)

Reconstitution Protocol

SC311120 is the updated version of SC116384.

USD 880.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "IKZF1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IKZF1
Synonyms CVID13; Hs.54452; IK1; IKAROS; LyF-1; LYF1; PPP1R92; PRO0758; ZNFN1A1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_006060, the custom clone sequence may differ by one or more nucleotides


ATGGATGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGGAAGGAAAGCCCCCCTGTAAGCGATACTC
CAGATGAGGGCGATGAGCCCATGCCGATCCCCGAGGACCTCTCCACCACCTCGGGAGGACAGCAAAGCTC
CAAGAGTGACAGAGTCGTGGCCAGTAATGTTAAAGTAGAGACTCAGAGTGATGAAGAGAATGGGCGTGCC
TGTGAAATGAATGGGGAAGAATGTGCGGAGGATTTACGAATGCTTGATGCCTCGGGAGAGAAAATGAATG
GCTCCCACAGGGACCAAGGCAGCTCGGCTTTGTCGGGAGTTGGAGGCATTCGACTTCCTAACGGAAAACT
AAAGTGTGATATCTGTGGGATCATTTGCATCGGGCCCAATGTGCTCATGGTTCACAAAAGAAGCCACACT
GGAGAACGGCCCTTCCAGTGCAATCAGTGCGGGGCCTCATTCACCCAGAAGGGCAACCTGCTCCGGCACA
TCAAGCTGCATTCCGGGGAGAAGCCCTTCAAATGCCACCTCTGCAACTACGCCTGCCGCCGGAGGGACGC
CCTCACTGGCCACCTGAGGACGCACTCCGTTGGTAAACCTCACAAATGTGGATATTGTGGCCGAAGCTAT
AAACAGCGAAGCTCTTTAGAGGAACATAAAGAGCGCTGCCACAACTACTTGGAAAGCATGGGCCTTCCGG
GCACACTGTACCCAGTCATTAAAGAAGAAACTAATCACAGTGAAATGGCAGAAGACCTGTGCAAGATAGG
ATCAGAGAGATCTCTCGTGCTGGACAGACTAGCAAGTAACGTCGCCAAACGTAAGAGCTCTATGCCTCAG
AAATTTCTTGGGGACAAGGGCCTGTCCGACACGCCCTACGACAGCAGCGCCAGCTACGAGAAGGAGAACG
AAATGATGAAGTCCCACGTGATGGACCAAGCCATCAACAACGCCATCAACTACCTGGGGGCCGAGTCCCT
GCGCCCGCTGGTGCAGACGCCCCCGGGCGGTTCCGAGGTGGTCCCGGTCATCAGCCCGATGTACCAGCTG
CACAAGCCGCTCGCGGAGGGCACCCCGCGCTCCAACCACTCGGCCCAGGACAGCGCCGTGGAGAACCTGC
TGCTGCTCTCCAAGGCCAAGTTGGTGCCCTCGGAGCGCGAGGCGTCCCCGAGCAACAGCTGCCAAGACTC
CACGGACACCGAGAGCAACAACGAGGAGCAGCGCAGCGGTCTCATCTACCTGACCAACCACATCGCCCCG
CACGCGCGCAACGGGCTGTCGCTCAAGGAGGAGCACCGCGCCTACGACCTGCTGCGCGCCGCCTCCGAGA
ACTCGCAGGACGCGCTCCGCGTGGTCAGCACCAGCGGGGAGCAGATGAAGGTGTACAAGTGCGAACACTG
CCGGGTGCTCTTCCTGGATCACGTCATGTACACCATCCACATGGGCTGCCACGGCTTCCGTGATCCTTTT
GAGTGCAACATGTGCGGCTACCACAGCCAGGACCGGTACGAGTTCTCGTCGCACATAACGCGAGGGGAGC
ACCGCTTCCACATGAGCTAA


Restriction Sites SgfI-MluI     
ACCN NM_006060
ORF Size 1560 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_006060.5, NP_006051.1
RefSeq Size 6317
RefSeq ORF 1560
Locus ID 10320
Domains zf-C2H2
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene encodes a transcription factor that belongs to the family of zinc-finger DNA-binding proteins associated with chromatin remodeling. The expression of this protein is restricted to the fetal and adult hemo-lymphopoietic system, and it functions as a regulator of lymphocyte differentiation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. Most isoforms share a common C-terminal domain, which contains two zinc finger motifs that are required for hetero- or homo-dimerization, and for interactions with other proteins. The isoforms, however, differ in the number of N-terminal zinc finger motifs that bind DNA and in nuclear localization signal presence, resulting in members with and without DNA-binding properties. Only a few isoforms contain the requisite three or more N-terminal zinc motifs that confer high affinity binding to a specific core DNA sequence element in the promoters of target genes. The non-DNA-binding isoforms are largely found in the cytoplasm, and are thought to function as dominant-negative factors. Overexpression of some dominant-negative isoforms have been associated with B-cell malignancies, such as acute lymphoblastic leukemia (ALL). [provided by RefSeq, May 2014]
Transcript Variant: This variant (1) encodes the longest isoform (1, also known as Ik-1 as described in PMID:12937159). This isoform contains four N-terminal zinc finger motifs, binds DNA, and is localized to the nucleus.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.