Urocortin 3 (UCN3) (NM_053049) Human Untagged Clone

CAT#: SC311129

UCN3 (untagged)-Human urocortin 3 (stresscopin) (UCN3)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UCN3
• Synonyms: SCP; SPC; UCNIII
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_053049, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGATGCCGGTCCACTTCCTGCTGCTCCTGCTGCTGCTCCTGGGGGGCCCCAGGACAGGCCTCCCCC
  ACAAGTTCTACAAAGCCAAGCCCATCTTCAGCTGCCTCAACACCGCCCTGTCTGAGGCTGAGAAGGGCCA
  GTGGGAGGATGCATCCCTGCTGAGCAAGAGGAGCTTCCACTACCTGCGCAGCAGAGACGCCTCTTCGGGA
  GAGGAGGAGGAGGGCAAAGAGAAAAAGACTTTCCCCATCTCTGGGGCCAGGGGTGGAGCCAGAGGCACCC
  GGTACAGATACGTGTCCCAAGCACAGCCCAGGGGAAAGCCACGCCAGGACACGGCCAAGAGTCCCCACCG
  CACCAAGTTCACCCTGTCCCTCGACGTCCCCACCAACATCATGAACCTCCTCTTCAACATCGCCAAGGCC
  AAGAACCTGCGTGCCCAGGCGGCCGCCAATGCCCACCTGATGGCGCAAATTGGGAGGAAGAAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_053049
• ORF Size: 486 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_053049.2, NP_444277.2
• RefSeq Size: 710
• RefSeq ORF: 486
• Locus ID: 114131
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a member of the sauvagine/corticotropin-releasing factor/urotensin I family of proteins. The encoded preproprotein is proteolytically processed to generate the mature peptide hormone, which is secreted by pancreatic beta and alpha cells. This hormone is an endogenous ligand for corticotropin-releasing factor receptor 2 and may regulate insulin secretion in response to plasma glucose levels. Patients with type 2 diabetes exhibit reduced levels of the encoded protein in beta cells. In the brain, the encoded protein may be responsible for the effects of stress on appetite. [provided by RefSeq, May 2016]