GDAP1 (NM_001040875) Human Untagged Clone

CAT#: SC311182

GDAP1 (untagged)-Human ganglioside-induced differentiation-associated protein 1 (GDAP1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GDAP1
• Synonyms: CMT4; CMT4A; CMTRIA
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001040875, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGTTTGAACTCAACTGGAGAAGTGCCTGTCCTTATCCACGGGGAAAACATAATTTGTGAGGCCACTC
  AGATCATTGATTATCTTGAACAGACTTTCCTGGATGAAAGAACACCCAGGTTAATGCCTGATAAAGAAAG
  CATGTATTACCCACGGGTACAACATTACCGAGAGCTGCTTGACTCCTTGCCAATGGATGCCTATACACAT
  GGCTGCATTTTACATCCTGAGTTAACTGTGGACTCCATGATCCCGGCTTATGCAACTACAAGGATTCGTA
  GCCAAATTGGAAACACAGAGTCTGAGCTGAAGAAACTTGCTGAAGAAAACCCAGATTTACAAGAAGCATA
  CATTGCAAAACAGAAACGACTTAAATCAAAGCTGCTTGATCATGACAATGTCAAGTATTTGAAGAAAATT
  CTTGATGAGTTGGAGAAAGTCTTGGATCAGGTTGAAACTGAATTGCAAAGAAGAAATGAAGAAACCCCAG
  AAGAGGGCCAGCAACCTTGGCTCTGCGGTGAATCCTTCACCCTGGCAGACGTCTCACTCGCTGTCACATT
  GCATCGACTGAAGTTCCTGGGGTTTGCAAGGAGAAACTGGGGAAACGGAAAGCGACCAAACTTGGAAACC
  TATTACGAGCGTGTCTTGAAGAGAAAAACATTTAACAAGGTTTTAGGACATGTCAACAATATATTAATCT
  CTGCAGTGCTGCCAACAGCATTCCGGGTGGCCAAGAAAAGGGCCCCAAAAGTTCTTGGCACGACCCTTGT
  GGTTGGTTTGCTTGCAGGAGTGGGATATTTTGCTTTTATGCTTTTCAGAAAGAGGCTTGGCAGCATGATA
  TTAGCATTTAGACCCAGACCAAATTATTTCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001040875
• ORF Size: 873 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001040875.2, NP_001035808.1
• RefSeq Size: 3769
• RefSeq ORF: 873
• Locus ID: 54332
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a member of the ganglioside-induced differentiation-associated protein family, which may play a role in a signal transduction pathway during neuronal development. Mutations in this gene have been associated with various forms of Charcot-Marie-Tooth Disease and neuropathy. Two transcript variants encoding different isoforms and a noncoding variant have been identified for this gene. [provided by RefSeq, Feb 2012]
  Transcript Variant: This variant (2) contains an alternate in-frame exon and uses an alternate splice site in the 5' coding region, and uses a downstream start codon, compared to variant 1. Isoform b has a shorter N-terminus, compared to isoform a.