NCALD (NM_001040624) Human Untagged Clone

CAT#: SC311189

NCALD (untagged)-Human neurocalcin delta (NCALD), transcript variant 1


  "NM_001040624" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NCALD"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NCALD
Synonyms MGC33870; MGC74858
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001040624, the custom clone sequence may differ by one or more nucleotides
ATGGGGAAACAGAACAGCAAGCTGCGCCCGGAGGTCATGCAGGACTTGCTGGAAAGCACA
GACTTTACAGAGCATGAGATCCAGGAATGGTATAAAGGCTTCTTGAGAGACTGCCCCAGT
GGACATTTGTCAATGGAAGAGTTTAAGAAAATATATGGGAACTTTTTCCCTTATGGGGAT
GCTTCCAAATTTGCAGAGCATGTCTTCCGCACCTTCGATGCAAATGGAGATGGGACAATA
GACTTTAGAGAATTCATCATCGCCTTGAGTGTAACTTCGAGGGGGAAGCTGGAGCAGAAG
CTGAAATGGGCCTTCAGCATGTACGACCTGGACGGAAATGGCTATATCAGCAAGGCAGAG
ATGCTAGAGATCGTGCAGGCAATCTATAAGATGGTTTCCTCTGTAATGAAAATGCCTGAA
GATGAGTCAACCCCAGAGAAAAGAACAGAAAAGATCTTCCGCCAGATGGACACCAATAGA
GACGGAAAACTCTCCCTGGAAGAGTTCATCCGAGGAGCCAAAAGCGACCCGTCCATTGTG
CGCCTCCTGCAGTGCGACCCGAGCAGTGCCGGCCAGTTCTGA
Restriction Sites Please inquire     
ACCN NM_001040624
ORF Size 582 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001040624.1, NP_001035714.1
RefSeq Size 3760
RefSeq ORF 582
Locus ID 83988
Gene Summary This gene encodes a member of the neuronal calcium sensor (NCS) family of calcium-binding proteins. The protein contains an N-terminal myristoylation signal and four EF-hand calcium binding loops. The protein is cytosolic at resting calcium levels; however, elevated intracellular calcium levels induce a conformational change that exposes the myristoyl group, resulting in protein association with membranes and partial co-localization with the perinuclear trans-golgi network. The protein is thought to be a regulator of G protein-coupled receptor signal transduction. Several alternatively spliced variants of this gene have been determined, all of which encode the same protein; additional variants may exist but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) includes five untranslated exons at the 5' end.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.