DEFB104B (NM_001040702) Human Untagged Clone

CAT#: SC311208

DEFB104B (untagged)-Human defensin, beta 104B (DEFB104B)


  "NM_001040702" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "DEFB104B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DEFB104B
Synonyms BD-4; DEFB-4; hBD-4
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001040702, the custom clone sequence may differ by one or more nucleotides
ATGCAGAGACTTGTGCTGCTATTAGCCATTTCTCTTCTACTCTATCAAGATCTTCCAGTG
AGAAGCGAATTTGAATTGGACAGAATATGTGGTTATGGGACTGCCCGTTGCCGGAAGAAA
TGTCGCAGCCAAGAATACAGAATTGGAAGATGTCCCAACACCTATGCATGCTGTTTGAGA
AAATGGGATGAGAGCTTACTGAATCGTACAAAACCCTGA
Restriction Sites Please inquire     
ACCN NM_001040702
ORF Size 219 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001040702.1, NP_001035792.1
RefSeq Size 281
RefSeq ORF 219
Locus ID 503618
Gene Summary Defensins form a family of antimicrobial and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Chromosome 8p23 contains at least two copies of the duplicated beta-defensin cluster. This duplication results in two identical copies of defensin, beta 104, DEFB104A and DEFB104B, in head-to-head orientation. This gene, DEFB104B, represents the more telomeric copy. [provided by RefSeq, Oct 2014]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.