DEFB104B (NM_001040702) Human Untagged Clone

CAT#: SC311208

DEFB104B (untagged)-Human defensin, beta 104B (DEFB104B)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DEFB104B
• Synonyms: BD-4; DEFB-4; hBD-4
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001040702, the custom clone sequence may differ by one or more nucleotides
  ATGCAGAGACTTGTGCTGCTATTAGCCATTTCTCTTCTACTCTATCAAGATCTTCCAGTG
  AGAAGCGAATTTGAATTGGACAGAATATGTGGTTATGGGACTGCCCGTTGCCGGAAGAAA
  TGTCGCAGCCAAGAATACAGAATTGGAAGATGTCCCAACACCTATGCATGCTGTTTGAGA
  AAATGGGATGAGAGCTTACTGAATCGTACAAAACCCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001040702
• ORF Size: 219 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001040702.1, NP_001035792.1
• RefSeq Size: 281
• RefSeq ORF: 219
• Locus ID: 503618
• Gene Summary: Defensins form a family of antimicrobial and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Chromosome 8p23 contains at least two copies of the duplicated beta-defensin cluster. This duplication results in two identical copies of defensin, beta 104, DEFB104A and DEFB104B, in head-to-head orientation. This gene, DEFB104B, represents the more telomeric copy. [provided by RefSeq, Oct 2014]