PTPN20B (PTPN20) (NM_001042364) Human Untagged Clone

CAT#: SC311223

PTPN20B (untagged)-Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 9


  "NM_001042364" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "PTPN20"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PTPN20
Synonyms bA42B19.1; bA142I17.1; CT126; PTPN20A; PTPN20B
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001042364, the custom clone sequence may differ by one or more nucleotides
ATGTGGACAGCCAGAGGCCCCTTCAGAAGAGACAGGTGGAGCAGTGAGGATGAGGAGGCT
GCAGGGCCATCACAGGCTCTCTCCCCTCTACTTTCTGATACGCGCAAAATTGTTTCTGAA
GGAGAACTAGATCAGTTGGCTCAGATTCGGCCATTAATATTCAATTTTCATGAGCAGACA
GCCATCAAGGATTGTTTGAAAATCCTTGAGGAAAAAACAGCAGCGTATGATATCATGCAG
GAATTTATGGCTTTAGAACTTAAGAATCTGCCTGGTGAGTTCAACTCTGGGAATCAACCA
AGCAACAGAGAAAAAAATAGATACCGAGATATTCTTCCATTTCAACATCATGGATATAGT
GGCCCAAATGAGAGAACAACGTTCTGGCATGGTTCAAACGAAGGAGCAGTATCACTTTTG
TTACGATATTGTGCTTGA
Restriction Sites Please inquire     
ACCN NM_001042364
ORF Size 438 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001042364.3, NP_001035823.1
RefSeq Size 2226
RefSeq ORF 438
Locus ID 26095
Protein Families Druggable Genome, Phosphatase
Gene Summary The product of this gene belongs to the family of classical tyrosine-specific protein tyrosine phosphatases. Many protein tyrosine phosphatases have been shown to regulate fundamental cellular processes. The encoded protein appears to be targeted to sites of actin polymerization. A pseudogene of this gene has been defined on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (9) differs in the 5' UTR and has multiple coding region differences, compared to variant 1, one of which results in a frameshift. These differences cause translation initiation at a downstream AUG and a protein (isoform 9) with a distinct C-terminus, compared to isoform 1. Variants 9, 32, and 33 all encode the same isoform (9).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.