PTPN20B (PTPN20) (NM_001042363) Human Untagged Clone
CAT#: SC311256
PTPN20B (untagged)-Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 8
"NM_001042363" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PTPN20 |
Synonyms | bA42B19.1; bA142I17.1; CT126; PTPN20A; PTPN20B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001042363, the custom clone sequence may differ by one or more nucleotides
ATGTGGACAGCCAGAGGCCCCTTCAGAAGAGACAGGTGGAGCAGTGAGGATGAGGAGGCTGCAGGGCCAT CACAGGCTCTCTCCCCTCTACTTTCTGATACGCGCAAAATTGTTTCTGAAGGAGAACTAGATCAGTTGGC TCAGATTCGGCCATTAATATTCAATTTTCATGAGCAGACAGCCATCAAGGATTGTTTGAAAATCCTTGAG GAAAAAACAGCAGCGTATGATATCATGCAGGAATTTATGGCTTTAGAACTTAAGAATCTGCCTGGTGAGT TCAACTCTGGGAATCAACCAAGCAACAGAGAAAAAAATAGATACCGAGATATTCTTCCATATGATTCAAC ACGCGTTCCTCTTGGAAAAAGCAAGGACTACATCAATGCTAGTTATATTAGAATAGTCAATTGTGGAGAA GAGTATTTTTATATCGCTACTCAAGGACCACTGCTGAGCACCATAGATGACTTTTGGCAAATGGTGTTGG AAAATAATTCAAATGTTATTGCCATGATAACCAGAGAGATAGAAGGTGGAATTATCAAATGCTACCATTA CTGGCCCATTTCTCTGAAGAAGCCATTGGAATTGAAACACTTCCGTGTATTCCTGGAGAACTACCAGATA CTTCAATATTTCATCATTCGAATGTTTCAAGTTGTGGAGAAGTCCACGGGAACTAGTCACTCTGTAAAAC AGTTGCAGTTCACCAAGTGGCCAGACCATGGCACTCCTGCCTCAGCAGATAGCTTCATAAAATATATTCG TTATGCAAGGAAGAGCCACCTTACAGGACCCATGGTTGTTCACTGCAGTGCCGGCATAGGCCGGACAGGG GTGTTCCTATGTGTGGATGTCGTGTTCTGTGCCATCGTAAAGAACTGTTCATTCAACATCATGGATATAG TGGCCCAAATGAGAGAACAACGTTCTGGCATGGTTCAAACGAAGGAGCAGTATCACTTTTGTTACGATAT TGTGCTTGAAGTTCTTCGGAAACTTCTGACTTTGGATTAA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001042363 |
ORF Size | 1020 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001042363.4, NP_001035822.1 |
RefSeq Size | 2930 |
RefSeq ORF | 1020 |
Locus ID | 26095 |
Protein Families | Druggable Genome, Phosphatase |
Gene Summary | The product of this gene belongs to the family of classical tyrosine-specific protein tyrosine phosphatases. Many protein tyrosine phosphatases have been shown to regulate fundamental cellular processes. The encoded protein appears to be targeted to sites of actin polymerization. A pseudogene of this gene has been defined on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (8) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start site compared to variant 1. The encoded isoform (8) has a shorter N-terminus compared to isoform 1. Variants 8, 11, and 12 all encode the same isoform (8). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212878 | PTPN20B (Myc-DDK-tagged)-Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 8 |
USD 420.00 |
|
RG212878 | PTPN20B (GFP-tagged) - Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 8 |
USD 460.00 |
|
RC212878L3 | Lenti ORF clone of Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 8, Myc-DDK-tagged |
USD 620.00 |
|
RC212878L4 | Lenti ORF clone of Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 8, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review