NCBP2 (NM_001042540) Human Untagged Clone
CAT#: SC311340
NCBP2 (untagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2
"NM_001042540" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NCBP2 |
Synonyms | CBC2; CBP20; NIP1; PIG55 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001042540, the custom clone sequence may differ by one or more nucleotides
ATGTCGGGTGGCCTCCTGAAGGCGCTGCGCAGCGACTCCTACGTGGAGCTGAGCCAGTAC CGGGACCAGCACTTCCGGGGTGACAATGAAGAACAAGAAAAATTACTGAAGAAAAGCTAT GCGGAAAACGCCATGCGGTACATAAATGGGACGCGTCTGGATGACCGAATCATTCGCACA GACTGGGACGCAGGCTTTAAGGAGGGCAGGCAATACGGCCGTGGGCGATCTGGGGGCCAG GTTCGGGATGAGTATCGGCAGGACTACGATGCTGGGAGAGGAGGCTATGGAAAACTGGCA CAGAACCAGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001042540 |
ORF Size | 312 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001042540.1, NP_001036005.1 |
RefSeq Size | 2016 |
RefSeq ORF | 312 |
Locus ID | 22916 |
Protein Families | Druggable Genome |
Protein Pathways | Spliceosome |
Gene Summary | The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein has an RNP domain commonly found in RNA binding proteins, and contains the cap-binding activity. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The encoded isoform (2) is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221605 | NCBP2 (Myc-DDK-tagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 |
USD 420.00 |
|
RG221605 | NCBP2 (GFP-tagged) - Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 |
USD 460.00 |
|
RC221605L1 | Lenti-ORF clone of NCBP2 (Myc-DDK-tagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 |
USD 620.00 |
|
RC221605L2 | Lenti-ORF clone of NCBP2 (mGFP-tagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 |
USD 620.00 |
|
RC221605L3 | Lenti-ORF clone of NCBP2 (Myc-DDK-tagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 |
USD 620.00 |
|
RC221605L4 | Lenti-ORF clone of NCBP2 (mGFP-tagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review