PIGY (NM_001042616) Human Untagged Clone

CAT#: SC311437

PIGY (untagged)-Human phosphatidylinositol glycan anchor biosynthesis, class Y (PIGY), nuclear gene encoding mitochondrial protein, transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PIGY
• Synonyms: HPMRS6; PIG-Y
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001042616, the custom clone sequence may differ by one or more nucleotides
  ATGTTTCTGTCTCTTCCTACGTTGACTGTTCTTATTCCACTGGTTTCTTTAGCAGGACTG
  TTCTACTCAGCCTCTGTGGAAGAAAACTTCCCACAGGGCTGCACTAGCACAGCCAGCCTT
  TGCTTTTACAGCCTGCTCTTGCCTATTACCATACCAGTGTATGTATTCTTCCACCTTTGG
  ACTTGGATGGGTATTAAACTCTTCAGGCATAATTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001042616
• ORF Size: 216 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001042616.1, NP_001036081.1
• RefSeq Size: 1353
• RefSeq ORF: 216
• Locus ID: 84992
• Protein Pathways: Glycosylphosphatidylinositol(GPI)-anchor biosynthesis, Metabolic pathways
• Gene Summary: The protein encoded by this gene is part of the GPI-N-acetylglucosaminyltransferase (GIP-GnT) complex which initiates the biosynthesis of glycosylphosphatidylinositol (GPI). GPI is synthesized in the endoplasmic reticulum and serves as an anchor for many surface proteins. Proteins containing GPI anchors can have an important role in cell-cell interactions. The transcript for this gene is bicistronic. The downstream open reading frame encodes this GPI-GnT complex protein, while the upstream open reading frame encodes a protein with unknown function, as represented by GeneID:100996939. [provided by RefSeq, Aug 2012]