S100A7L2 (NM_001045479) Human Untagged Clone

CAT#: SC311438

S100A7L2 (untagged)-Human S100 calcium binding protein A7-like 2 (S100A7L2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: S100A7L2
• Synonyms: S100a7b
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001045479, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTTCCCAGCTCTGGCTTTTTGAAAGCAAAGATGAATATCCCTCTAGGTGAGAAAGTCATGTTGGACA
  TAGTCGCGATGTTTCGCCAATACAGTGGAGATGATGGTAGGATGGACATGCCAGGTCTGGTGAACTTGAT
  GAAGGAGAACTTCCCCAACTTCCTCAGTGGCTGTGAAAAAAGCGACATGGATTACTTGTCCAATGCCCTT
  GAGAAAAAAGATGATAATAAGGATAAGAAGGTTAATTATTCTGAGTTTCTTTCCTTGCTGGGGGATATAA
  CCATAGACCACCACAAGATAATGCATGGAGTGGCACCCTGTTCCGGGGGAAGCCAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001045479
• ORF Size: 339 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001045479.1, NP_001038944.2
• RefSeq Size: 480
• RefSeq ORF: 339
• Locus ID: 645922
• Gene Summary: This locus is currently categorized as a non-transcribed pseudogene, but the locus type of this gene is unclear since it does contain an intact CDS. This locus lacks evidence indicating that it is transcribed, and very little of the upstream regions found in other family members are present at this locus. [provided by RefSeq, May 2018]