RHOC (NM_001042678) Human Untagged Clone

CAT#: SC311454

RHOC (untagged)-Human ras homolog gene family, member C (RHOC), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RHOC
• Synonyms: ARH9; ARHC; H9; RHOH9
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001042678, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGCAATCCGAAAGAAGCTGGTGATCGTTGGGGATGGTGCCTGTGGGAAGACCTGCCTCCTCATCG
  TCTTCAGCAAGGATCAGTTTCCGGAGGTCTACGTCCCTACTGTCTTTGAGAACTATATTGCGGACATTGA
  GGTGGACGGCAAGCAGGTGGAGCTGGCTCTGTGGGACACAGCAGGGCAGGAAGACTATGATCGACTGCGG
  CCTCTCTCCTACCCGGACACTGATGTCATCCTCATGTGCTTCTCCATCGACAGCCCTGACAGCCTGGAAA
  ACATTCCTGAGAAGTGGACCCCAGAGGTGAAGCACTTCTGCCCCAACGTGCCCATCATCCTGGTGGGGAA
  TAAGAAGGACCTGAGGCAAGACGAGCACACCAGGAGAGAGCTGGCCAAGATGAAGCAGGAGCCCGTTCGG
  TCTGAGGAAGGCCGGGACATGGCGAACCGGATCAGTGCCTTTGGCTACCTTGAGTGCTCAGCCAAGACCA
  AGGAGGGAGTGCGGGAGGTGTTTGAGATGGCCACTCGGGCTGGCCTCCAGGTCCGCAAGAACAAGCGTCG
  GAGGGGCTGTCCCATTCTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001042678
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001042678.1, NP_001036143.1
• RefSeq Size: 1346 bp
• RefSeq ORF: 582 bp
• Locus ID: 389
• Cytogenetics: 1p13.2
• Protein Families: Druggable Genome
• Gene Summary: 'This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. The protein encoded by this gene is prenylated at its C-terminus, and localizes to the cytoplasm and plasma membrane. It is thought to be important in cell locomotion. Overexpression of this gene is associated with tumor cell proliferation and metastasis. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR compared to variant 1. Variants 1, 2, and 3 encode the same protein.