ATCAY (AK055252) Human Untagged Clone

CAT#: SC311938

(untagged)-Human cDNA FLJ30690 fis, clone FCBBF2000576

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATCAY
• Synonyms: C15orf38
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for AK055252, the custom clone sequence may differ by one or more nucleotides
  ATGGAGGGGCTGGCTGTTCCCAGAGCAGGTCACTCCCCCACTTGCATTGCCTTGCCTGGA
  CTCTTTTCTTGGAGGGAGGTCCCTTTCCTCTACCCATCTGAATTTTTTTTTCTTCCACCA
  GTGTCCAGCTTGCCTTTCACCATGGGCCTAATGATGGAAATTACAGTTATTTTGTATCTT
  CAAACAGAACCAAGCAAATCCTCTGAGCTTCATTCATATGGGAAATTTTCTTTCTTTCTT
  TTTTTTTTTTTTGAGATGGAATTTCGCTCTTGTTGCCCAGGCTGGAGTGCAATGGCTCAA
  TCTCGGCTCACTGCAACCTCCACCTCCCAGGTTCAAGAGTTTCTCCTGCCTCAGCAGGAG
  GATTACTGTAATCCCAAG
  
• Restriction Sites: Please inquire
• ACCN: AK055252
• ORF Size: 2452 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: AK055252.1
• RefSeq Size: 2452
• RefSeq ORF: 2452
• Locus ID: 85300
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a neuron-restricted protein that contains a CRAL-TRIO motif common to proteins that bind small lipophilic molecules. Mutations in this gene are associated with cerebellar ataxia, Cayman type. [provided by RefSeq, Jul 2008]