ATCAY (AK055252) Human Untagged Clone
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "ATCAY"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ATCAY |
Synonyms | C15orf38 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AK055252, the custom clone sequence may differ by one or more nucleotides
ATGGAGGGGCTGGCTGTTCCCAGAGCAGGTCACTCCCCCACTTGCATTGCCTTGCCTGGA CTCTTTTCTTGGAGGGAGGTCCCTTTCCTCTACCCATCTGAATTTTTTTTTCTTCCACCA GTGTCCAGCTTGCCTTTCACCATGGGCCTAATGATGGAAATTACAGTTATTTTGTATCTT CAAACAGAACCAAGCAAATCCTCTGAGCTTCATTCATATGGGAAATTTTCTTTCTTTCTT TTTTTTTTTTTTGAGATGGAATTTCGCTCTTGTTGCCCAGGCTGGAGTGCAATGGCTCAA TCTCGGCTCACTGCAACCTCCACCTCCCAGGTTCAAGAGTTTCTCCTGCCTCAGCAGGAG GATTACTGTAATCCCAAG |
Restriction Sites | Please inquire |
ACCN | AK055252 |
ORF Size | 2452 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | AK055252.1 |
RefSeq Size | 2452 |
RefSeq ORF | 2452 |
Locus ID | 85300 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a neuron-restricted protein that contains a CRAL-TRIO motif common to proteins that bind small lipophilic molecules. Mutations in this gene are associated with cerebellar ataxia, Cayman type. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.