ARPC4 (AK024110) Human Untagged Clone

CAT#: SC312201

(untagged)-Human cDNA FLJ14048 fis, clone HEMBA1006650, weakly similar to ARP2/3 COMPLEX 20 KD SUBUNIT

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ARPC4
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for AK024110, the custom clone sequence may differ by one or more nucleotides
  ATGACTGCCACTCTCCGCCCCTACCTGAGTGCCGTGCGGGCCACATTGCAGGCTGCCCTC
  TGCCTGGAGAACTTCTCCTCCCAGGTTGTGGAACGACACAACAAGCCGGAAGTGGAAGTC
  AGGAGTAGCAAAGAGCTCCTGTTACAACCTGTGACCATCAGCAGGAATGGGAAGGAAAAG
  GTTCTGATTGAGGGCTCCATCAACTCTGTCCGGGTCAGCATTGCTGTGAAACAGGCTGAT
  GAGATCGAGAAGATTTTGTGCCACAAGTTGAATAGTGCAGGGTGGCCCAGGGCTGCTTCC
  AGGACTTGCCTGTCCTCCCTGGGTTTGGATGGGAGAGACACAAGGGCCTGGACCTCAGTT
  TTCTGTTCTCTGCCCCAGCTCAGTGCACCTGTGCAACAACTCCATCCAGAAGCACCTGGA
  GAACTCATGCCATCGGCATCCACTGCTTCCGCCAGACAACATGTGGTC
  
• Restriction Sites: Please inquire
• ACCN: AK024110
• ORF Size: 471 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: AK024110.1, BAB14828.1
• RefSeq Size: 1958
• RefSeq ORF: 471
• Locus ID: 10093
• Protein Pathways: Fc gamma R-mediated phagocytosis, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton
• Gene Summary: This gene encodes one of seven subunits of the human Arp2/3 protein complex. This complex controls actin polymerization in cells and has been conserved throughout eukaryotic evolution. This gene encodes the p20 subunit, which is necessary for actin nucleation and high-affinity binding to F-actin. Alternative splicing results in multiple transcript variants. Naturally occurring read-through transcription exists between this gene and the downstream tubulin tyrosine ligase-like family, member 3 (TTLL3), which results in the production of a fusion protein. [provided by RefSeq, Nov 2010]