Dystonin (DST) (AK025142) Human Untagged Clone

CAT#: SC312279

(untagged)-Human cDNA: FLJ21489 fis, clone COL05450


Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DST
Synonyms BP240|BPA|BPAG1|CATX-15|CATX15|D6S1101|DMH|DT|EBSB2|HSAN6|MACF2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK025142, the custom clone sequence may differ by one or more nucleotides
ATGGAGTGGCTAGAAGAGTCAGAAAAGTCTTTGGATTCTGAACTGGAAATCGCAAATGAT
CCAGACAAAATAAAAACACAACTTGCACAACATAAGGAGTTTCAGAAATCACTCGGAGCC
AAGCATTCTGTCTACGACACCACCAACAGGACTGGACGTTCTCTGAAGGAGAAAACCTCC
CTGGCTGATGACAACCTGAAACTGGATGACATGCTGAGTGAACTCAGAGACAAATGGGAT
ACCATATGTGGAAAATCTGTGGAAAGACAAAACAAATTGGAGGAAGCCCTGTTATTTTCT
GGACAATTCACAGATGCCCTACAGGCTCTCATTGATTGGTTATATAGAGTTGAACCCCAG
CTGGCAGAAGACCAGCCTGTTCATGGAGACATTGATTTGGTGATGAATCTGATCGATAAT
CACAAGGTATTGTTATCTGGGACATTTTATTTTATCTTGTTTGATTATTCTGAGTGTACA
GGAAATGTAAACCATTTAAAT
Restriction Sites Please inquire     
ACCN AK025142
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq AK025142.1, BAB15077.1
RefSeq Size 2250 bp
RefSeq ORF 2250 bp
Locus ID 667
Cytogenetics 6p12.1
Domains spectrin
Gene Summary 'This gene encodes a member of the plakin protein family of adhesion junction plaque proteins. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the full-length nature of some variants has not been defined. It has been reported that some isoforms are expressed in neural and muscle tissue, anchoring neural intermediate filaments to the actin cytoskeleton, and some isoforms are expressed in epithelial tissue, anchoring keratin-containing intermediate filaments to hemidesmosomes. Consistent with the expression, mice defective for this gene show skin blistering and neurodegeneration. [provided by RefSeq, Mar 2010]'

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.