ATG4A (AK054927) Human Untagged Clone
CAT#: SC312283
(untagged)-Human cDNA FLJ30365 fis, clone BRACE2007784, weakly similar to Putative Protein that mediates attachment of autophagosomes to microtubules
Product Images
Other products for "ATG4A"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ATG4A |
Synonyms | APG4A|AUTL2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AK054927, the custom clone sequence may differ by one or more nucleotides
ATGGAGTCAGTTTTATCCAAGTATGAAGATCAGATTACTATTTTCACTGACTACCTAGAA GAATATCCAGATACAGATGAGCTGGTATGGATCTTAGGGAAGCAGCATCTCCTTAAAACA GAAAAATCTAAGCTGTTGTCTGATATAAGTGCTCGTCTATGGTTTACATACAGAAGGAAA TTTTCACCAATTGGTGGAACGGGCCCTTCATCAGATGCTGGTTGGGGATGTATGCTACGC TGTGGACAGATGATGCTGGCTCAAGCCCTTATCTGTAGACACTTGGGAAGGGACTGGAGC TGGGAGAAACAAAAAGAACAACCCAAAGAATACCAACGCATCCTACAGTGCTTCTTAGAT AGAAAAGATTGTTGCTACTCTATCCATCAAATGGAAAAAATGTGCCGTGTCCTTCCCTTG AGTGCTGACACAGCTGGTGACAGGCCTCCCGATTCTTTAACTGCTTCAAACCAGAGTAAG GGCACCTCTGCCTACTGCTCAGCC |
Restriction Sites | Please inquire |
ACCN | AK054927 |
ORF Size | 1940 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | AK054927.1 |
RefSeq Size | 1940 |
RefSeq ORF | 1940 |
Locus ID | 115201 |
Domains | Peptidase_C54 |
Protein Families | Protease |
Protein Pathways | Regulation of autophagy |
Gene Summary | Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. [provided by RefSeq, Mar 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.