DCTN3 (AK091661) Human Untagged Clone
CAT#: SC312308
(untagged)-Human cDNA FLJ34342 fis, clone FEBRA2009986, moderately similar to Dynactin 3 (p22), dynactin light chain
Product Images
Other products for "DCTN3"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DCTN3 |
Synonyms | DCTN-22|DCTN22 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AK091661, the custom clone sequence may differ by one or more nucleotides
ATGGCGGGTCTGACTGACTTGCAGCGGCTACAGGCCCGAGTGGAAGAGCTGGAGCGCTGG GTGTACGGGCCGGGCGGGGCGCGCGGCTCACGGAAGGTGGCTGACGGCCTGGTCAAGGTG CAGGTGGCTTTGGGGAACATTTCCAGCAAGAGGGAGAGGGTGAAGATTCTCTACAAAAAG ATTGAAGATCTGATCAAGTACCTGGATCCTGAGTACATCGACCGCATTGCCATACCTGAT GCCTCTAAGCTGCAATTCATCCTAGCAGGTAATGCTGGACTACATGTGTACATGCATCTG AGGATGTGGGTCGTCGGGGAGGTTAAGCACAGAGATGGCCTCTCCATCCAGTCTTCTGGT GGATACAAGCCCTGGATGCTGCTCTCTGGAATTGTGGCCTGGTTCTGGGTTGAGGATCCT ATGGATCCTCTAGTAGACATTGAGTACAGTATACCTCTGCACCAGCTGCAGGCCATGGTG CCAGCCACAGTGGGAGCTAGTCCAGTGTTCTATCAA |
Restriction Sites | Please inquire |
ACCN | AK091661 |
ORF Size | 519 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | AK091661.1, BAC03716.1 |
RefSeq Size | 3877 |
RefSeq ORF | 519 |
Locus ID | 11258 |
Gene Summary | This gene encodes the smallest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, cytokinesis, chromosome movement, nuclear positioning, and axonogenesis. This subunit, like most other dynactin subunits, exists only as a part of the dynactin complex. It is primarily an alpha-helical protein with very little coiled coil, and binds directly to the largest subunit (p150) of dynactin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.