DYNC1LI2 (AK098365) Human Untagged Clone
Product Images
Other products for "DYNC1LI2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DYNC1LI2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AK098365, the custom clone sequence may differ by one or more nucleotides
ATGATACGTGTTCCTTGCATATGGCACTGTCTAGAGGGGACATACACAGCTGAAGAAGGG AAGGGCAGTGATGGGGTTATGGAGGAAGTATGGCAGGGAAAGCAGGAGGGTGATGCTGGA AGACAAATGGTAGATCCCAGGCGGACTGGAAAGAATTGCAATAGGGGGAGCCGGGGAGTG CAGTCTGTGAGAGGCTGGAAATGTGAAAGCCAGGAGCTCTCAGGGATTTGGGTTGCCTCC TGCACAGTCAAGGAGAGTGTCACTCAGGCTAGTCATAGATGGCATACCTACAGGCTTGGG CTGATTTTAGATAGTTGTTCAGAGCAGTCAGGCAGGCGCCAGAGGCACAAGCCCTGTGAG AGGTGTGTTTGGAATCACTTGGTATCCAAATCACATGTCATCCCTAGGAGCAAGGAGACC GGTTGGATTTGGGGCTGGTCTGGAATGAAGAAGCATCTCTCAGCTTCTGAAGGCTGCATG GCTCACGGCAGTATCTCAATCATGCCCTGCCCGTTTGCACATTTGGTCCTGTTGGTAGTT ACCAGGTTGTCTAGG |
Restriction Sites | Please inquire |
ACCN | AK098365 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | AK098365.1, BAC05293.1 |
RefSeq Size | 1789 bp |
RefSeq ORF | 558 bp |
Locus ID | 1783 |
Cytogenetics | 16q22.1 |
Protein Families | Druggable Genome |
Gene Summary | 'Cytoplasmic dynein is a microtubule-associated motor protein (Hughes et al., 1995 [PubMed 7738094]). See DYNC1H1 (MIM 600112) for general information about dyneins.[supplied by OMIM, Mar 2008]' |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.