HGS (AK097197) Human Untagged Clone

CAT#: SC312374

(untagged)-Human cDNA FLJ39878 fis, clone SPLEN2016045, moderately similar to Human mRNA for Hrs

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HGS
• Synonyms: HRS
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for AK097197, the custom clone sequence may differ by one or more nucleotides
  ATGCGGCAGAAGAAGCAGGTGCAGTGGCTGCCCAGCCACAGGCCGGGGCCGGCTGGGGGA
  CCTCGCAGCATAACCAGCATGTTTTTGCCGCACAGGAGTACCTGGAGGTGCAGAGGCAGC
  TGGCCATCCAGCGCCTGCAGGAGCAGGAGAAGGAGCGGCAGATGCGGCTGGAGCAGCAGA
  AGCAGACGGTCCAGATGCGCGCGCAGATGCCCGCCTTCCCCCTGCCCTACGCCCAGGCAT
  GTGCCATCCTCCCGCCACCCAGAGGCTTGTGGGCTGAGGACCAACTCTCACCGCTGTCTC
  TTTTGTCCCCAGCTCCAGGCCATGCCCGCAGCCGGAGGCGTGCTCTACCAGCCCTCGGGA
  CCAGCCAGCTTCCCCAGCACCTTCAGCCCCGCCGGCTCGGTGGAGGGCTCCCCAATGCAC
  GGCGTGTACATGAGCCAGCCGGCCCCTGCCGCTGGCCCCTACCCCAGCATGCCCAGCACT
  GCGGCTGGTAAGGACGGGTCGGGGCAGAGACCATGCCTTTTATCCCTCGTCTTTATTTTA
  GCCGAATTTACAGAAAAGCAG
  
• Restriction Sites: Please inquire
• ACCN: AK097197
• ORF Size: 3103 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: AK097197.1
• RefSeq Size: 3103
• RefSeq ORF: 3103
• Locus ID: 9146
• Protein Families: Druggable Genome
• Protein Pathways: Endocytosis
• Gene Summary: The protein encoded by this gene regulates endosomal sorting and plays a critical role in the recycling and degradation of membrane receptors. The encoded protein sorts monoubiquitinated membrane proteins into the multivesicular body, targeting these proteins for lysosome-dependent degradation. [provided by RefSeq, Dec 2010]