RASSF1 (NM_170712) Human Untagged Clone
CAT#: SC312380
RASSF1 (untagged)-Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant B
"NM_170712" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RASSF1 |
Synonyms | 123F2; NORE2A; RASSF1A; RDA32; REH3P21 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_170712, the custom clone sequence may differ by one or more nucleotides
ATGAGCTTGAACAAGGACGGTTCTTACACAGGCTTCATCAAGGTTCAGCTGAAGCTGGTGCGCCCTGTCT CTGTGCCCTCCAGCAAGAAGCCACCCTCCTTGCAGGATGCCCGGCGGGGCCCAGGACGGGGCACAAGTGT CAGGCGCCGCACTTCCTTTTACCTGCCCAAGGATGCTGTCAAGCACCTGCATGTGCTGTCACGCACAAGG GCACGTGAAGTCATTGAGGCCCTGCTGCGAAAGTTCTTGGTGGTGGATGACCCCCGCAAGTTTGCACTCT TTGAGCGCGCTGAGCGTCACGGCCAAGTGTACTTGCGGAAGCTGTTGGATGATGAGCAGCCCCTGCGGCT GCGGCTCCTGGCAGGGCCCAGTGACAAGGCCCTGAGCTTTGTCCTGAAGGAAAATGACTCTGGGGAGGTG AACTGGGACGCCTTCAGCATGCCTGAACTACATAACTTCCTACGTATCCTGCAGCGGGAGGAGGAGGAGC ACCTCCGCCAGATCCTGCAGAAGTACTCCTATTGCCGCCAGAAGATCCAAGAGGCCCTGCACGCCTGCCC CCTTGGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_170712 |
ORF Size | 570 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_170712.2, NP_733830.1 |
RefSeq Size | 1676 |
RefSeq ORF | 570 |
Locus ID | 11186 |
Protein Families | Druggable Genome |
Protein Pathways | Bladder cancer, Non-small cell lung cancer, Pathways in cancer |
Gene Summary | This gene encodes a protein similar to the RAS effector proteins. Loss or altered expression of this gene has been associated with the pathogenesis of a variety of cancers, which suggests the tumor suppressor function of this gene. The inactivation of this gene was found to be correlated with the hypermethylation of its CpG-island promoter region. The encoded protein was found to interact with DNA repair protein XPA. The protein was also shown to inhibit the accumulation of cyclin D1, and thus induce cell cycle arrest. Several alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, May 2011] Transcript Variant: This variant (B) differs in the 5' end region compared to variant D. The resulting isoform (B) has a shorter N-terminus, as compared to isoform D. Variants B and H both encode the same isoform (B). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210715 | RASSF1 (Myc-DDK-tagged)-Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant B |
USD 98.00 |
|
RG210715 | RASSF1 (GFP-tagged) - Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant B |
USD 460.00 |
|
RC210715L3 | Lenti ORF clone of Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant B, Myc-DDK-tagged |
USD 620.00 |
|
RC210715L4 | Lenti ORF clone of Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant B, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review