CLEC2D (NM_013269) Human Untagged Clone

CAT#: SC312389

CLEC2D (untagged)-Human C-type lectin domain family 2, member D (CLEC2D), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLEC2D
• Synonyms: CLAX; LLT1; OCIL
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_013269 edited
  ATGCATGACAGTAACAATGTGGAGAAAGACATTACACCATCTGAATTGCCTGCAAACCCA
  GGTTGTCTGCATTCAAAAGAGCATTCTATTAAAGCTACCTTAATTTGGCGCTTATTTTTC
  TTAATCATGTTTCTGACAATCATAGTGTGTGGAATGGTTGCTGCTTTAAGCGCAATAAGA
  GCTAACTGCCATCAAGAGCCATCAGTATGTCTTCAAGCTGCATGCCCAGAAAGCTGGATT
  GGTTTTCAAAGAAAGTGTTTCTATTTTTCTGATGACACCAAGAACTGGACATCAAGTCAG
  AGGTTTTGTGACTCACAAGATGCTGATCTTGCTCAGGTTGAAAGCTTCCAGGAACTGAAT
  TTCCTGTTGAGATATAAAGGCCCATCTGATCACTGGATTGGGCTGAGCAGAGAACAAGGC
  CAACCATGGAAATGGATAAATGGTACTGAATGGACAAGACAGTTTCCTATCCTGGGAGCA
  GGAGAGTGTGCCTATTTGAATGACAAAGGTGCCAGTAGTGCCAGGCACTACACAGAGAGG
  AAGTGGATTTGTTCCAAATCAGATATACATGTCTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_013269
• ORF Size: 576 bp
• Insert Size: 2200
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_013269.2, NP_037401.1
• RefSeq Size: 1739
• RefSeq ORF: 576
• Locus ID: 29121
• Domains: CLECT
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a member of the natural killer cell receptor C-type lectin family. The encoded protein inhibits osteoclast formation and contains a transmembrane domain near the N-terminus as well as the C-type lectin-like extracellular domain. Several alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Oct 2010]
  Transcript Variant: This variant (1) represents the most frequently occurring transcript. It encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.