C9orf72 (AK057806) Human Untagged Clone

CAT#: SC312514

(untagged)-Human cDNA FLJ25077 fis, clone CBL06922


Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "C9orf72"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol C9orf72
Synonyms ALSFTD|FTDALS|FTDALS1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK057806, the custom clone sequence may differ by one or more nucleotides
ATGTCGACTCTTTGCCCACCGCCATCTCCAGCTGTTGCCAAGACAGAGATTGCTTTAAGT
GGCAAATCACCTTTATTAGCAGCTACTTTTGCTTACTGGGACAATATTCTTGGTCCTAGA
GTAAGGCACATTTGGGCTCCAAAGACAGAACAGGTACTTCTCAGTGATGGAGAAATAACT
TTTCTTGCCAACCACACTCTAAATGGAGAAATCCTTCGAAATGCAGAGAGTGGTGCTATA
GATGTAAAGTTTTTTGTCTTGTCTGAAAAGGGAGTGATTATTGTTTCATTAATCTTTGAT
GGAAACTGGAATGGGGATCGCAGCACATATGGACTATCAATTATACTTCCACAGACAGAA
CTTAGTTTCTACCTCCCACTTCATAGAGTGTGTGTTGATAGATTAACACATATAATCCGG
AAAGGAAGAATATGGATGCATAAGGAAAGACAAGAAAATGTCCAGAAGATTATCTTAGAA
GGCACAGAGAGAATGGAAGATCAGGGTCAGAGTATTATTCCAATGCTTACTGGAGAAGTG
ATTCCTGTAATGGAACTGCTTTCATCTATGAAATCACACAGTGTTCCTGAAGAAATAGAT
ATAGCTGATACAGTACTCAATGATGATGATATTGGTGACAGCTGTCATGAAGGCTTTCTT
CTCAAG
Restriction Sites Please inquire     
ACCN AK057806
ORF Size 669 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq AK057806.1, BAB71583.1
RefSeq Size 1564
RefSeq ORF 669
Locus ID 203228
Gene Summary The protein encoded by this gene plays an important role in the regulation of endosomal trafficking, and has been shown to interact with Rab proteins that are involved in autophagy and endocytic transport. Expansion of a GGGGCC repeat from 2-22 copies to 700-1600 copies in the intronic sequence between alternate 5' exons in transcripts from this gene is associated with 9p-linked ALS (amyotrophic lateral sclerosis) and FTD (frontotemporal dementia) (PMID: 21944778, 21944779). Studies suggest that hexanucleotide expansions could result in the selective stabilization of repeat-containing pre-mRNA, and the accumulation of insoluble dipeptide repeat protein aggregates that could be pathogenic in FTD-ALS patients (PMID: 23393093). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2016]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.