GALNT9 (NM_021808) Human Untagged Clone

CAT#: SC312588

GALNT9 (untagged)-Human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9) (GALNT9), transcript variant B

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GALNT9
• Synonyms: GALNAC-T9; GALNACT9
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_021808 edited
  AGGCCAACTTCAGCCTGGCACGGCGGCGCCGCGGACTCCACCATCCCGGGGAAGGAGCCG
  GACCCCTGTGTGGCAGTGTGGCGGCAGCATGGAGGTGCTGCCCTGCTCCCGCGTGGCCCA
  CATCGAGCGCACCAGGAAGCCCTACAACAACGACATTGACTACTACGCCAAGCGCAACGC
  CCTGCGCGCCGCCGAGGTGTGGATGGATGACTTCAAGTCCCACGTGTACATGGCCTGGAA
  CATCCCCATGTCGAACCCAGGGGTGGACTTCGGGGACGTGTCTGAGAGGCTGGCCCTGCG
  TCAGAGGCTGAAGTGTCGCAGCTTCAAGTGGTACCTGGAGAACGTGTACCCGGAGATGAG
  GGTCTACAACAACACCCTCACGTACGGAGAGGTGAGAAACAGCAAAGCCAGTGCCTACTG
  TCTGGACCAGGGAGCGGAGGACGGCGACCGGGCGATCCTCTACCCCTGCCACGGGATGTC
  CTCCCAGCTGGTGCGGTACAGCGCTGACGGCCTGCTGCAGCTGGGGCCTCTGGGCTCCAC
  AGCCTTCTTGCCTGACTCCAAGTGTCTGGTGGATGACGGCACGGGCCGCATGCCCACCCT
  GAAGAAGTGTGAGGATGTGGCGCGGCCAACACAGCGGCTGTGGGACTTCACCCAGAGTGG
  CCCCATTGTGAGCCGGGCCACGGGCCGCTGCCTGGAGGTGGAGATGTCCAAAGATGCCAA
  CTTTGGGCTCCGGCTGGTGGTACAGAGGTGCTCGGGGCAGAAGTGGATGATCAGAAACTG
  GATCAAACACGCACGGCACTGACCCCACCTCCGCCCGGACCCCCACAGACCTCGGG
  
• Restriction Sites: Please inquire
• ACCN: NM_021808
• ORF Size: 714 bp
• Insert Size: 800
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_021808.2, NP_068580.2
• RefSeq Size: 1741
• RefSeq ORF: 714
• Locus ID: 50614
• Protein Families: Transmembrane
• Protein Pathways: Metabolic pathways, O-Glycan biosynthesis
• Gene Summary: This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. This gene is expressed specifically in the brain, with highest expression in the cerebellum. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (B) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant A. The resulting isoform (B) has a shorter N-terminus compared to isoform A, and lacks the glycosyltransferase domain.