TL1A (TNFSF15) (NM_005118) Human Untagged Clone

CAT#: SC312650

TNFSF15 (untagged)-Human tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TNFSF15
• Synonyms: TL1; TL1A; TNLG1B; VEGI; VEGI192A
• Vector: pCMV6-XL6
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_005118 edited
  ATGGCCGAGGATCTGGGACTGAGCTTTGGGGAAACAGCCAGTGTGGAAATGCTGCCAGAG
  CACGGCAGCTGCAGGCCCAAGGCCAGGAGCAGCAGCGCACGCTGGGCTCTCACCTGCTGC
  CTGGTGTTGCTCCCCTTCCTTGCAGGACTCACCACATACCTGCTTGTCAGCCAGCTCCGG
  GCCCAGGGAGAGGCCTGTGTGCAGTTCCAGGCTCTAAAAGGACAGGAGTTTGCACCTTCA
  CATCAGCAAGTTTATGCACCTCTTAGAGCAGACGGAGATAAGCCAAGGGCACACCTGACA
  GTTGTGAGACAAACTCCCACACAGCACTTTAAAAATCAGTTCCCAGCTCTGCACTGGGAA
  CATGAACTAGGCCTGGCCTTCACCAAGAACCGAATGAACTATACCAACAAATTCCTGCTG
  ATCCCAGAGTCGGGAGACTACTTCATTTACTCCCAGGTCACATTCCGTGGGATGACCTCT
  GAGTGCAGTGAAATCAGACAAGCAGGCCGACCAAACAAGCCAGACTCCATCACTGTGGTC
  ATCACCAAGGTAACAGACAGCTACCCTGAGCCAACCCAGCTCCTCATGGGGACCAAGTCT
  GTGTGCGAAGTAGGTAGCAACTGGTTCCAGCCCATCTACCTCGGAGCCATGTTCTCCTTG
  CAAGAAGGGGACAAGCTAATGGTGAACGTCAGTGACATCTCTTTGGTGGATTACACAAAA
  GAAGATAAAACCTTCTTTGGAGCCTTCTTACTATAG
  
• Restriction Sites: NotI-NotI
• ACCN: NM_005118
• ORF Size: 756 bp
• Insert Size: 2400
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005118.2.

Reference Data

• RefSeq: NM_005118.2, NP_005109.2
• RefSeq Size: 2011
• RefSeq ORF: 756
• Locus ID: 9966
• Domains: TNF
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction
• Gene Summary: The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein is abundantly expressed in endothelial cells, but is not expressed in either B or T cells. The expression of this protein is inducible by TNF and IL-1 alpha. This cytokine is a ligand for receptor TNFRSF25 and decoy receptor TNFRSF21/DR6. It can activate NF-kappaB and MAP kinases, and acts as an autocrine factor to induce apoptosis in endothelial cells. This cytokine is also found to inhibit endothelial cell proliferation, and thus may function as an angiogenesis inhibitor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (VEGI-251). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.