TAZ (NM_181311) Human Untagged Clone

CAT#: SC312695

TAZ (untagged)-Human tafazzin (TAZ), nuclear gene encoding mitochondrial protein, transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TAZ
• Synonyms: BTHS; CMD3A; EFE; EFE2; G4.5; LVNCX; Taz1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_181311, the custom clone sequence may differ by one or more nucleotides
  ATGCCTCTGCACGTGAAGTGGCCGTTCCCCGCGGTGCCGCCGCTCACCTGGACCCTGGCC
  AGCAGCGTCGTCATGGGCTTGGTGGGCACCTACAGCTGCTTCTGGACCAAGTACATGAAC
  CACCTGACCGTGCACAACAGGGAGGTGCTGTACGAGCTCATCGAGAAGCGAGGCCCGGCC
  ACGCCCCTCATCACCGTGTCCAATCACCAGTCCTGCATGGACGACCCTCATCTCTGGGGG
  ATCCTGAAACTCCGCCACATCTGGAACCTGAAGTTGATGCGTTGGACCCCTGCAGCTGCA
  GACATCTGCTTCACCAAGGAGCTACACTCCCACTTCTTCAGCTTGGGCAAGTGTGTGCCT
  GTGTGCCGAGGAGATGGCGTCTACCAGAAGGGGATGGACTTCATTTTGGAGAAGCTCAAC
  CATGGGGACTGGGTGCATATCTTCCCAGAAGGGAAAGTGAACATGAGTTCCGAATTCCTG
  CGTTTCAAGTGGGGAATCGGGCGCCTGATTGCTGAGTGTCATCTCAACCCCATCATCCTG
  CCCCTGTGGCATGTCGGAATGAATGACGTCCTTCCTAACAGTCCGCCCTACTTCCCCCGC
  TTTGGACAGAAAATCACTGTGCTGATCGGGAAGCCCTTCAGTGCCCTGCCTGTACTCGAG
  CGGCTCCGGGCGGAGAACAAGTCGGCTGTGGAGATGCGGAAAGCCCTGACGGACTTCATT
  CAAGAGGAATTCCAGCATCTGAAGACTCAGGCAGAGCAGCTCCACAACCACCTCCAGCCT
  GGGAGA
  
• Restriction Sites: Please inquire
• ACCN: NM_181311
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_181311.1, NP_851828.1
• RefSeq Size: 1814 bp
• RefSeq ORF: 789 bp
• Locus ID: 6901
• Cytogenetics: Xq28
• Protein Families: ES Cell Differentiation/IPS, Transmembrane
• Gene Summary: 'This gene encodes a protein that is expressed at high levels in cardiac and skeletal muscle. Mutations in this gene have been associated with a number of clinical disorders including Barth syndrome, dilated cardiomyopathy (DCM), hypertrophic DCM, endocardial fibroelastosis, and left ventricular noncompaction (LVNC). Multiple transcript variants encoding different isoforms have been described. A long form and a short form of each of these isoforms is produced; the short form lacks a hydrophobic leader sequence and may exist as a cytoplasmic protein rather than being membrane-bound. Other alternatively spliced transcripts have been described but the full-length nature of all these transcripts is not known. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) lacks an in-frame coding exon compared to variant 1, resulting in a shorter isoform (2) compared to isoform 1.