ADA2 (NM_177405) Human Untagged Clone
CAT#: SC312735
CECR1 (untagged)-Human cat eye syndrome chromosome region, candidate 1 (CECR1), transcript variant 2
"NM_177405" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ADA2 |
Synonyms | ADGF; CECR1; IDGFL; PAN; SNEDS; VAIHS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_177405, the custom clone sequence may differ by one or more nucleotides
ATGGATTCCCTGGAATGGAACTGGGCTCTGGTGTATGAGCTCAGTGGAGAGCACCATGACGAAGAGTGGT CAGTGAAGACTTACCAGGAAGTAGCTCAGAAGTTTGTGGAAACTCACCCTGAGTTTATTGGAATCAAAAT CATTTATTCGGATCACAGATCCAAAGATGTGGCTGTCATCGCAGAATCCATCCGAATGGCCATGGGGCTC CGAATCAAGTTCCCCACGGTGGTGGCAGGGTTTGACCTGGTGGGGCATGAGGACACTGGCCACTCCTTGC ATGACTACAAGGAAGCTCTGATGATCCCCGCCAAGGATGGCGTTAAGCTGCCTTACTTCTTCCACGCCGG AGAAACAGACTGGCAGGGTACTTCCATAGACAGGAACATTCTGGATGCTCTGATGCTGAACACTACCAGA ATCGGCCATGGATTTGCTTTGAGCAAACACCCCGCAGTCAGGACTTACTCCTGGAAAAAGGACATCCCCA TAGAAGTCTGTCCCATCTCTAACCAGGTGCTGAAACTGGTGTCTGACTTGAGGAACCACCCTGTAGCCAC TCTGATGGCCACTGGGCACCCCATGGTGATCAGCTCTGATGACCCAGCTATGTTTGGTGCCAAAGGCTTG TCCTATGATTTCTATGAGGTCTTCATGGGCATTGGGGGGATGAAGGCTGACCTGAGGACCCTCAAACAGC TGGCCATGAACTCTATCAAGTACAGTACCCTGTTGGAGAGTGAGAAAAATACTTTCATGGAAATCTGGAA GAAGAGATGGGATAAGTTCATAGCAGATGTGGCTACAAAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_177405 |
ORF Size | 813 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_177405.2, NP_803124.1 |
RefSeq Size | 3716 |
RefSeq ORF | 813 |
Locus ID | 51816 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Gene Summary | This gene encodes a member of a subfamily of the adenosine deaminase protein family. The encoded protein is one of two adenosine deaminases found in humans, which regulate levels of the signaling molecule, adenosine. The encoded protein is secreted from monocytes undergoing differentiation and may regulate cell proliferation and differentiation. This gene may be responsible for some of the phenotypic features associated with cat eye syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (2) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 3. The resulting isoform (b) has a shorter N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214292 | CECR1 (Myc-DDK-tagged)-Human cat eye syndrome chromosome region, candidate 1 (CECR1), transcript variant 2 |
USD 420.00 |
|
RG214292 | CECR1 (GFP-tagged) - Human cat eye syndrome chromosome region, candidate 1 (CECR1), transcript variant 2 |
USD 460.00 |
|
RC214292L1 | Lenti ORF clone of Human cat eye syndrome chromosome region, candidate 1 (CECR1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC214292L2 | Lenti ORF clone of Human cat eye syndrome chromosome region, candidate 1 (CECR1), transcript variant 2, mGFP tagged |
USD 768.00 |
|
RC214292L3 | Lenti ORF clone of Human cat eye syndrome chromosome region, candidate 1 (CECR1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC214292L4 | Lenti ORF clone of Human cat eye syndrome chromosome region, candidate 1 (CECR1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review