Dysbindin (DTNBP1) (NM_183040) Human Untagged Clone

CAT#: SC312871

DTNBP1 (untagged)-Human dystrobrevin binding protein 1 (DTNBP1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DTNBP1
• Synonyms: BLOC1S8; DBND; HPS7; My031; SDY
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_183040, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGGAGACCCTTCGCGAGCGGCTGCTGAGCGTGCAGCAGGATTTCACCTCCGGGCTGAAGACTTTAA
  GTGACAAGTCAAGAGAAGCAAAAGTGAAAAGCAAACCCAGGACTGTTCCATTTTTGCCAAAGTACTCTGC
  TGGATTAGAATTACTTAGCAGGTATGAGGATACATGGGCTGCACTTCACAGAAGAGCCAAAGACTGTGCA
  AGTGCTGGAGAGCTGGTGGATAGCGAGGTGGTCATGCTTTCTGCGCACTGGGAGAAGAAAAAGACAAGCC
  TCGTGGAGCTGCAAGAGCAGCTCCAGCAGCTCCCAGCTTTAATCGCAGACTTAGAATCCATGACAGCAAA
  TCTGACTCATTTAGAGGCGAGTTTTGAGGAGGTAGAGAACAACCTGCTGCATCTGGAAGACTTATGTGGG
  CAGTGTGAATTAGAAAGATGCAAACATATGCAGTCCCAGCAACTGGAGAATTACAAGAAAAATAAGAGGA
  AGGAACTTGAAACCTTCAAAGCTGAACTAGATGCAGAGCACGCCCAGAAGGTCCTGGAAATGGAGCACAC
  CCAGCAAATGAAGCTGAAGGAGCGGCAGAAGTTTTTTGAGGAAGCCTTCCAGCAGGACATGGAGCAGTAC
  CTGTCCACTGGCTACCTGCAGATTGCAGAGCGGCGAGAGCCCATAGGCAGCATGTCATCCATGGAAGTGA
  ACGTGGACATGCTGGAGCAGATGGACCTGATGGACATATCGGACCAGGAGGCCCTGGACGTCTTCCTGAA
  CTCTGGAGGAGAAGAGAACACTGTGCTGTCCCCCGCCTTAGGTAGGGTTGACAAACTTGCATTAGCTGAA
  CCAGGGCAGTATCGATGCCACTCCCCTCCAAAGGTGAGACGTGAGAACCATCTGCCAGTCACTTACGCAT
  AA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_183040
• ORF Size: 912 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_183040.2, NP_898861.1
• RefSeq Size: 1963
• RefSeq ORF: 912
• Locus ID: 84062
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. A similar protein in mouse is a component of a protein complex termed biogenesis of lysosome-related organelles complex 1 (BLOC-1), and binds to alpha- and beta-dystrobrevins, which are components of the dystrophin-associated protein complex (DPC). Mutations in this gene are associated with Hermansky-Pudlak syndrome type 7. This gene may also be associated with schizophrenia. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) contains an additional segment in the coding region compared to variant 1. The resulting isoform (b) contains a shorter and distinct C-terminus compared to isoform a. This protein isoform is described by Talbot et al. (PMID:21390302).