Ataxin 3 (ATXN3) (NM_030660) Human Untagged Clone
CAT#: SC312878
ATXN3 (untagged)-Human ataxin 3 (ATXN3), transcript variant h
"NM_030660" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ATXN3 |
Synonyms | AT3; ATX3; JOS; MJD; MJD1; SCA3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_030660, the custom clone sequence may differ by one or more nucleotides
ATGGAGTCCATCTTCCACGAGAAACAGCCTTCTGGAAATATGGATGACAGTGGTTTTTTCTCTATTCAGG TTATAAGCAATGCCTTGAAAGTTTGGGGTTTAGAACTAATCCTGTTCAACAGTCCAGAGTATCAGAGGCT CAGGATCGATCCTATAAATGAAAGATCATTTATATGCAATTATAAGGAACACTGGTTTACAGTTAGAAAA TTAGGAAAACAGTGGTTTAACTTGAATTCTCTCTTGACGGGTCCAGAATTAATATCAGATACATATCTTG CACTTTTCTTGGCTCAATTACAACAGGAAGGTTATTCTATATTTGTCGTTAAGGGTGATCTGCCAGATTG CGAAGCTGACCAACTCCTGCAGATGATTAGGGTCCAACAGATGCATCGACCAAAACTTATTGGAGAAGAA TTAGCACAACTAAAAGAGCAAAGAGTCCATAAAACAGACCTGGAACGAGTGTTAGAAGCAAATGATGGCT CAGGAATGTTAGACGAAGATGAGGAGGATTTGCAGAGGGCTCTGGCACTAAGTCGCCAAGAAATTGACAT GGAAGATGAGGAAGCAGATCTCCGCAGGGCTATTCAGCTAAGTATGCAAGGTAGTTCCAGAAACATATCT CAAGATATGACACAGACATCAGGTACAAATCTTACTTCAGAAGAGCTTCGGAAGAGACGAGAAGCCTACT TTGAAAAACAGCAGCAAAAGCAGCAACAGCAGCAGCAGCAGCAGCAGCAGGGGGACCTATCAGGACAGAG TTCACATCCATGTGAAAGGCCAGCCACCAGTTCAGGAGCACTTGGGAGTGATCTAGGTGATGCTATGAGT GAAGAAGACATGCTTCAGGCAGCTGTGACCATGTCTTTAGAAACTGTCAGAAATGATTTGAAAACAGAAG GAAAAAAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_030660 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_030660.4, NP_109376.1 |
RefSeq Size | 6758 bp |
RefSeq ORF | 921 bp |
Locus ID | 4287 |
Cytogenetics | 14q32.12 |
Domains | UIM, Josephin |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | 'Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 12-44 to 52-86 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2016]' Transcript Variant: This variant (h, also known as variant 2) is one of several transcript variants described in figure 2 of Bettencourt et al. (PMID: 19714377). This variant encodes isoform h (also known as isoform 2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218985 | ATXN3 (Myc-DDK-tagged)-Human ataxin 3 (ATXN3), transcript variant h |
USD 420.00 |
|
RG218985 | ATXN3 (GFP-tagged) - Human ataxin 3 (ATXN3), transcript variant h |
USD 460.00 |
|
RC218985L3 | Lenti ORF clone of Human ataxin 3 (ATXN3), transcript variant h, Myc-DDK-tagged |
USD 620.00 |
|
RC218985L4 | Lenti ORF clone of Human ataxin 3 (ATXN3), transcript variant h, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review