Calpain 3 (CAPN3) (NM_173088) Human Untagged Clone
CAT#: SC312896
CAPN3 (untagged)-Human calpain 3, (p94) (CAPN3), transcript variant 4
"NM_173088" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CAPN3 |
Synonyms | CANP3; CANPL3; LGMD2; LGMD2A; LGMDD4; LGMDR1; nCL-1; p94 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_173088, the custom clone sequence may differ by one or more nucleotides
ATGCACGGGAACAAGCAGCACCTGCAGAAGGACTTCTTCCTGTACAACGCCTCCAAGGCCAGGAGCAAAA CCTACATCAACATGCGGGAGGTGTCCCAGCGCTTCCGCCTGCCTCCCAGCGAGTACGTCATCGTGCCCTC CACCTACGAGCCCCACCAGGAGGGGGAATTCATCCTCCGGGTCTTCTCTGAAAAGAGGAACCTCTCTGAG GAAGTTGAAAATACCATCTCCGTGGATCGGCCAGTGAAAAAGAAAAAAACCAAGCCCATCATCTTCGTTT CGGACAGAGCAAACAGCAACAAGGAGCTGGGTGTGGACCAGGAGTCAGAGGAGGGCAAAGGCAAAACAAG CCCTGATAAGCAAAAGCAGTCCCCACAGCCACAGCCTGGCAGCTCTGATCAGGAAAGTGAGGAACAGCAA CAATTCCGGAACATTTTCAAGCAGATAGCAGGAGATGACATGGAGATCTGTGCAGATGAGCTCAAGAAGG TCCTTAACACAGTCGTGAACAAACACAAGGACCTGAAGACACACGGGTTCACACTGGAGTCCTGCCGTAG CATGATTGCGCTCATGGATACAGATGGCTCTGGAAAGCTCAACCTGCAGGAGTTCCACCACCTCTGGAAC AAGATTAAGGCCTGGCAGAAAATTTTCAAACACTATGACACAGACCAGTCCGGCACCATCAACAGCTACG AGATGCGAAATGCAGTCAACGACGCAGGATTCCACCTCAACAACCAGCTCTATGACATCATTACCATGCG GTACGCAGACAAACACATGAACATCGACTTTGACAGTTTCATCTGCTGCTTCGTTAGGCTGGAGGGCATG TTCAGAGCTTTTCATGCATTTGACAAGGATGGAGATGGTATCATCAAGCTCAACGTTCTGGAGTGGCTGC AGCTCACCATGTATGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_173088 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_173088.1, NP_775111.1 |
RefSeq Size | 1661 bp |
RefSeq ORF | 930 bp |
Locus ID | 825 |
Cytogenetics | 15q15.1 |
Protein Families | Druggable Genome, Protease |
Gene Summary | 'Calpain, a heterodimer consisting of a large and a small subunit, is a major intracellular protease, although its function has not been well established. This gene encodes a muscle-specific member of the calpain large subunit family that specifically binds to titin. Mutations in this gene are associated with limb-girdle muscular dystrophies type 2A. Alternate promoters and alternative splicing result in multiple transcript variants encoding different isoforms and some variants are ubiquitously expressed. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (4) differs in the 5' UTR and 5' coding region, and uses a downstream start codon, compared to variant 1. It encodes isoform d, which has a shorter N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221186 | CAPN3 (Myc-DDK-tagged)-Human calpain 3, (p94) (CAPN3), transcript variant 4 |
USD 420.00 |
|
RG221186 | CAPN3 (GFP-tagged) - Human calpain 3, (p94) (CAPN3), transcript variant 4 |
USD 460.00 |
|
RC221186L3 | Lenti-ORF clone of CAPN3 (Myc-DDK-tagged)-Human calpain 3, (p94) (CAPN3), transcript variant 4 |
USD 620.00 |
|
RC221186L4 | Lenti-ORF clone of CAPN3 (mGFP-tagged)-Human calpain 3, (p94) (CAPN3), transcript variant 4 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review