PHC2 (NM_004427) Human Untagged Clone

CAT#: SC312947

PHC2 (untagged)-Human polyhomeotic homolog 2 (Drosophila) (PHC2), transcript variant 2


  "NM_004427" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PHC2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PHC2
Synonyms EDR2; HPH2; PH2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_004427, the custom clone sequence may differ by one or more nucleotides


ATGACCTCAGGGAACGGAAACTCTGCCTCCAGCATCGCCGGCACTGCCCCCCAGAATGGTGAGAATAAAC
CACCACAGGCCATTGTGAAACCCCAAATCCTGACGCATGTTATCGAAGGGTTTGTGATCCAGGAGGGGGC
GGAGCCTTTCCCGGTGGGACGCTCGTCCCTGCTGGTGGGGAATCTCAAGAAGAAGTATGCACAGGGGTTC
CTGCCTGAGAAACTTCCACAGCAGGATCACACCACCACCACTGACTCGGAGATGGAGGAGCCCTATCTGC
AAGAATCCAAAGAGGAGGGTGCTCCCCTCAAACTCAAGTGTGAGCTCTGTGGCCGGGTGGACTTTGCCTA
TAAGTTCAAGCGTTCCAAGCGCTTCTGTTCCATGGCTTGTGCAAAGAGGTACAACGTGGGATGCACCAAA
CGGGTGGGACTTTTCCACTCAGACCGGAGCAAGCTGCAGAAGGCAGGAGCTGCGACCCACAACCGCCGTC
GGGCCAGCAAAGCCAGTCTGCCACCACTTACCAAGGATACCAAGAAGCAGCCAACAGGCACTGTGCCCCT
TTCGGTTACTGCTGCTTTGCAGCTAACACACAGCCAGGAAGACTCCAGCCGTTGCTCAGATAACTCAAGC
TATGAGGAACCCTTGTCACCCATCTCAGCCAGCTCATCTACTTCCCGCCGGCGACAAGGCCAGCGGGACC
TGGAGCTCCCCGACATGCATATGCGGGACCTGGTGGGCATGGGACACCACTTCCTGCCAAGTGAGCCCAC
CAAGTGGAATGTAGAAGACGTCTACGAATTCATCCGCTCTCTGCCAGGCTGCCAGGAGATAGCAGAGGAA
TTCCGTGCCCAGGAAATCGACGGGCAAGCCCTGCTGCTGCTCAAGGAGGACCACCTGATGAGCGCCATGA
ACATCAAGCTGGGGCCCGCCCTGAAGATCTACGCCCGCATCAGCATGCTCAAGGACTCCTAG


Restriction Sites SgfI-MluI     
ACCN NM_004427
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004427.3, NP_004418.2
RefSeq Size 2566 bp
RefSeq ORF 972 bp
Locus ID 1912
Cytogenetics 1p35.1
Gene Summary 'In Drosophila melanogaster, the 'Polycomb' group (PcG) of genes are part of a cellular memory system that is responsible for the stable inheritance of gene activity. PcG proteins form a large multimeric, chromatin-associated protein complex. The protein encoded by this gene has homology to the Drosophila PcG protein 'polyhomeotic' (Ph) and is known to heterodimerize with EDR1 and colocalize with BMI1 in interphase nuclei of human cells. The specific function in human cells has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (b) has a shorter N-terminus compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.