ATG4A (NM_178270) Human Untagged Clone

CAT#: SC313005

ATG4A (untagged)-Human ATG4 autophagy related 4 homolog A (S. cerevisiae) (ATG4A), transcript variant 2


  "NM_178270" in other vectors (4)

Reconstitution Protocol

USD 580.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ATG4A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ATG4A
Synonyms APG4A; AUTL2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_178270, the custom clone sequence may differ by one or more nucleotides


ATGGAGTCAGTTTTATCCAAGTATGAAGATCAGATTACTATTTTCACTGACTACCTAGAAGAATATCCAG
ATACAGATGAGCTGGTATGGATCTTAGGGAAGCAGCATCTCCTTAAAACAGAAAAATCTAAGCTGTTGTC
TGATATAAGTGCTCGTCTATGGTTTACATACAGAAGGAAATTTTCACCAATTGGTGGAACGGGCCCTTCA
TCAGATGCTGGTTGGGGATGTATGCTACGCTGTGGACAGATGATGCTGGCTCAAGCCCTTATCTGTAGAC
ACTTGGGAAGGGACTGGAGCTGGGAGAAACAAAAAGAACAACCCAAAGAATACCAACGCATCCTACAGTG
CTTCTTAGATAGAAAAGATTGTTGCTACTCTATCCATCAAATGGCACAAATGGGTGTAGGAGAAGGGAAA
TCAATTGGAGAATGGTTTGGACCAAATACAGTTGCACAGGTGTTAAAAAAACTTGCTTTATTTGACGAAT
GGAATTCCTTGGCTGTTTATGTTTCAATGGATAACACAGTGGTCATTGAAGATATCAAAAAAATGTGCCG
TGTCCTTCCCTTGAGTGCTGACACAGCTGGTGACAGGCCTCCCGATTCTTTAACTGCTTCAAACCAGAGT
GACGAGCTCATCTTCTTGGACCCTCATACAACCCAGACCTTTGTTGACACTGAAGAGAATGGAACGGTTA
ATGACCAGACTTTCCATTGCCTGCAGTCCCCACAGCGAATGAACATCCTAAACCTGGATCCTTCAGTTGC
ATTGGGATTTTTCTGCAAAGAAGAAAAAGACTTTGATAACTGGTGTAGCCTTGTTCAGAAGGAAATTCTA
AAGGAGAATTTAAGGATGTTTGAATTAGTTCAGAAACATCCATCACACTGGCCTCCCTTTGTACCTCCAG
CCAAGCCAGAAGTGACAACCACTGGGGCAGAATTCATTGACTCTACTGAGCAACTGGAGGAGTTTGATCT
GGAGGAAGATTTTGAGATTCTGAGTGTGTAG


Restriction Sites SgfI-MluI     
ACCN NM_178270
ORF Size 1011 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_178270.3, NP_840054.1
RefSeq Size 2142
RefSeq ORF 1011
Locus ID 115201
Protein Families Protease
Protein Pathways Regulation of autophagy
Gene Summary Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (2) encodes isoform b.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.