ATG4A (NM_178270) Human Untagged Clone
CAT#: SC313005
ATG4A (untagged)-Human ATG4 autophagy related 4 homolog A (S. cerevisiae) (ATG4A), transcript variant 2
"NM_178270" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ATG4A |
Synonyms | APG4A; AUTL2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_178270, the custom clone sequence may differ by one or more nucleotides
ATGGAGTCAGTTTTATCCAAGTATGAAGATCAGATTACTATTTTCACTGACTACCTAGAAGAATATCCAG ATACAGATGAGCTGGTATGGATCTTAGGGAAGCAGCATCTCCTTAAAACAGAAAAATCTAAGCTGTTGTC TGATATAAGTGCTCGTCTATGGTTTACATACAGAAGGAAATTTTCACCAATTGGTGGAACGGGCCCTTCA TCAGATGCTGGTTGGGGATGTATGCTACGCTGTGGACAGATGATGCTGGCTCAAGCCCTTATCTGTAGAC ACTTGGGAAGGGACTGGAGCTGGGAGAAACAAAAAGAACAACCCAAAGAATACCAACGCATCCTACAGTG CTTCTTAGATAGAAAAGATTGTTGCTACTCTATCCATCAAATGGCACAAATGGGTGTAGGAGAAGGGAAA TCAATTGGAGAATGGTTTGGACCAAATACAGTTGCACAGGTGTTAAAAAAACTTGCTTTATTTGACGAAT GGAATTCCTTGGCTGTTTATGTTTCAATGGATAACACAGTGGTCATTGAAGATATCAAAAAAATGTGCCG TGTCCTTCCCTTGAGTGCTGACACAGCTGGTGACAGGCCTCCCGATTCTTTAACTGCTTCAAACCAGAGT GACGAGCTCATCTTCTTGGACCCTCATACAACCCAGACCTTTGTTGACACTGAAGAGAATGGAACGGTTA ATGACCAGACTTTCCATTGCCTGCAGTCCCCACAGCGAATGAACATCCTAAACCTGGATCCTTCAGTTGC ATTGGGATTTTTCTGCAAAGAAGAAAAAGACTTTGATAACTGGTGTAGCCTTGTTCAGAAGGAAATTCTA AAGGAGAATTTAAGGATGTTTGAATTAGTTCAGAAACATCCATCACACTGGCCTCCCTTTGTACCTCCAG CCAAGCCAGAAGTGACAACCACTGGGGCAGAATTCATTGACTCTACTGAGCAACTGGAGGAGTTTGATCT GGAGGAAGATTTTGAGATTCTGAGTGTGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_178270 |
ORF Size | 1011 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_178270.3, NP_840054.1 |
RefSeq Size | 2142 |
RefSeq ORF | 1011 |
Locus ID | 115201 |
Protein Families | Protease |
Protein Pathways | Regulation of autophagy |
Gene Summary | Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. [provided by RefSeq, Mar 2016] Transcript Variant: This variant (2) encodes isoform b. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215833 | ATG4A (Myc-DDK-tagged)-Human ATG4 autophagy related 4 homolog A (S. cerevisiae) (ATG4A), transcript variant 2 |
USD 420.00 |
|
RG215833 | ATG4A (GFP-tagged) - Human ATG4 autophagy related 4 homolog A (S. cerevisiae) (ATG4A), transcript variant 2 |
USD 460.00 |
|
RC215833L3 | Lenti ORF clone of Human ATG4 autophagy related 4 homolog A (S. cerevisiae) (ATG4A), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC215833L4 | Lenti ORF clone of Human ATG4 autophagy related 4 homolog A (S. cerevisiae) (ATG4A), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review