Macrophage Scavenger Receptor I (MSR1) (NM_002445) Human Untagged Clone
CAT#: SC313114
MSR1 (untagged)-Human macrophage scavenger receptor 1 (MSR1), transcript variant SR-AII
"NM_002445" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MSR1 |
Synonyms | CD204; phSR1; phSR2; SCARA1; SR-A; SR-AI; SR-AII; SR-AIII; SRA |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_002445 edited
ATAAATCAGTGCTGCTTTCTTTAGGACGAAAGAAGTATGGAGCAGTGGGATCACTTTCAC AATCAACAGGAGGACACTGATAGCTGCTCCGAATCTGTGAAATTTGATGCTCGCTCAATG ACAGCTTTGCTTCCTCCGAATCCTAAAAACAGCCCTTCCCTTCAAGAGAAACTGAAGTCC TTCAAAGCTGCACTGATTGCCCTTTACCTCCTCGTGTTTGCAGTTCTCATCCCTCTCATT GGAATAGTGGCAGCTCAACTCCTGAAGTGGGAAACGAAGAATTGCTCAGTTAGTTCAACT AATGCAAATGATATAACTCAAAGTCTCACGGGAAAAGGAAATGACAGCGAAGAGGAAATG AGATTTCAAGAAGTCTTTATGGAACACATGAGCAACATGGAGAAGAGAATCCAGCATATT TTAGACATGGAAGCCAACCTCATGGACACAGAGCATTTCCAAAATTTCAGCATGACAACT GATCAAAGATTTAATGACATTCTTCTGCAGCTAAGTACCTTGTTTTCCTCAGTCCAGGGA CATGGGAATGCAATAGATGAAATCTCCAAGTCCTTAATAAGTTTGAATACCACATTGCTT GATTTGCAGCTCAACATAGAAAATCTGAATGGCAAAATCCAAGAGAATACCTTCAAACAA CAAGAGGAAATCAGTAAATTAGAGGAGCGTGTTTACAATGTATCAGCAGAAATTATGGCT ATGAAAGAAGAACAAGTGCATTTGGAACAGGAAATAAAAGGAGAAGTGAAAGTACTGAAT AACATCACTAATGATCTCAGACTGAAAGATTGGGAACATTCTCAGACCTTGAGAAATATC ACTTTAATTCAAGGTCCTCCTGGACCCCCGGGTGAAAAAGGAGATCGAGGTCCCACTGGA GAAAGTGGTCCACGAGGATTTCCAGGTCCAATAGGTCCTCCGGGTCTTAAAGGTGATCGG GGAGCAATTGGCTTTCCTGGAAGTCGAGGACTCCCAGGATATGCCGGAAGGCCAGGAAAT TCTGGACCAAAAGGCCAGAAAGGGGAAAAGGGGAGTGGAAACACATTAAGACCAGTACAA CTCACTGATCATATTAGGGCAGGGCCCTCTTAA |
Restriction Sites | Please inquire |
ACCN | NM_002445 |
Insert Size | 1100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002445.2. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002445.2, NP_002436.1 |
RefSeq Size | 2823 bp |
RefSeq ORF | 1077 bp |
Locus ID | 4481 |
Cytogenetics | 8p22 |
Domains | Macscav_rec, Collagen |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | 'This gene encodes the class A macrophage scavenger receptors, which include three different types (1, 2, 3) generated by alternative splicing of this gene. These receptors or isoforms are macrophage-specific trimeric integral membrane glycoproteins and have been implicated in many macrophage-associated physiological and pathological processes including atherosclerosis, Alzheimer's disease, and host defense. The isoforms type 1 and type 2 are functional receptors and are able to mediate the endocytosis of modified low density lipoproteins (LDLs). The isoform type 3 does not internalize modified LDL (acetyl-LDL) despite having the domain shown to mediate this function in the types 1 and 2 isoforms. It has an altered intracellular processing and is trapped within the endoplasmic reticulum, making it unable to perform endocytosis. The isoform type 3 can inhibit the function of isoforms type 1 and type 2 when co-expressed, indicating a dominant negative effect and suggesting a mechanism for regulation of scavenger receptor activity in macrophages. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (SR-AII), also known as phSR2, uses two alternative exons and also lacks two downstream exons compared to variant SR-AI. These differences causes an alternate 3' end in the coding region, and has a distinct 3' UTR. It encodes isoform type 2 that is shorter and has a different C-terminus than isoform type 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212931 | MSR1 (Myc-DDK-tagged)-Human macrophage scavenger receptor 1 (MSR1), transcript variant SR-AII |
USD 420.00 |
|
RG212931 | MSR1 (GFP-tagged) - Human macrophage scavenger receptor 1 (MSR1), transcript variant SR-AII |
USD 460.00 |
|
RC212931L1 | Lenti ORF clone of Human macrophage scavenger receptor 1 (MSR1), transcript variant SR-AII, Myc-DDK-tagged |
USD 768.00 |
|
RC212931L2 | Lenti ORF clone of Human macrophage scavenger receptor 1 (MSR1), transcript variant SR-AII, mGFP tagged |
USD 620.00 |
|
RC212931L3 | Lenti ORF clone of Human macrophage scavenger receptor 1 (MSR1), transcript variant SR-AII, Myc-DDK-tagged |
USD 620.00 |
|
RC212931L4 | Lenti ORF clone of Human macrophage scavenger receptor 1 (MSR1), transcript variant SR-AII, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review