Dystrobrevin alpha (DTNA) (NM_001392) Human Untagged Clone

CAT#: SC313189

DTNA (untagged)-Human dystrobrevin, alpha (DTNA), transcript variant 7

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DTNA
• Synonyms: D18S892E; DRP3; DTN; DTN-A; LVNC1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001392, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATTGAAGATAGTGGGAAAAGAGGAAATACCATGGCAGAAAGAAGACAGCTGTTTGCAGAGATGAGGG
  CTCAAGATCTGGATCGCATCCGACTCTCCACCTACAGAACAGCATGCAAGCTTAGGTTTGTTCAGAAGAA
  ATGCAATTTGCACCTGGTGGACATATGGAATGTCATAGAAGCATTGCGGGAAAATGCTCTGAACAACCTG
  GACCCAAACACTGAACTCAACGTGTCCCGCTTAGAGGCTGTGCTCTCCACTATTTTTTACCAGCTCAACA
  AACGGATGCCAACCACTCACCAAATCCATGTGGAGCAGTCCATCAGCCTCCTCCTTAACTTCCTGCTTGC
  AGCGTTTGATCCGGAAGGCCATGGTAAAATTTCAGTATTTGCTGTCAAAATGGCTTTAGCCACATTGTGT
  GGAGGGAAGATCATGGACAAATTAAGATATATTTTCTCAATGATTTCTGACTCCAGTGGGGTGATGGTTT
  ATGGACGATATGACCAATTCCTTCGGGAAGTTCTCAAACTACCCACGGCAGTTTTTGAAGGTCCTTCATT
  TGGTTACACAGAACAGTCAGCCAGATCCTGTTTCTCCCAACAGAAAAAAGTCACGTTAAATGGTTTCTTG
  GACACGCTTATGTCAGATCCTCCCCCGCAGTGTCTGGTCTGGTTGCCTCTTCTGCATCGACTAGCAAATG
  TGGAAAATGTCTTCCATCCGGTTGAGTGTTCCTACTGCCACAGTGAGAGTATGATGGGATTTCGCTACCG
  ATGCCAACAGTGTCACAATTACCAGCTCTGTCAGGACTGCTTCTGGAGGGGACATGCCGGTGGTTCTCAT
  AGCAACCAGCACCAAATGAAAGAGTACACGTCATGGAAATCACCTGCTAAGAAGCTGACTAATGCATTAA
  GCAAGTCCCTGAGCTGTGCTTCCAGCCGTGAACCTTTGCACCCCATGTTCCCAGATCAGCCTGAGAAGCC
  ACTCAACTTGGCTCACATCGTTGATACTTGGCCTCCCAGACCTGTAACCAGCATGAACGACACCCTGTTC
  TCCCACTCTGTTCCCTCCTCAGGAAGTCCTTTTATTACCAGGAGCTCGGACGGTGCTTTTGGTGGATGCG
  TCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001392
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001392.4, NP_001383.2
• RefSeq Size: 1763 bp
• RefSeq ORF: 1125 bp
• Locus ID: 1837
• Cytogenetics: 18q12.1
• Domains: ZnF_ZZ
• Protein Families: Druggable Genome
• Gene Summary: 'The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (7), also known as DTN3 or delta transcript, lacks multiple exons from the 3' end and contains an alternate 3' exon, compared to transcript variant 1. This results in a shorter isoform (7) with a distinct C-terminus compared to isoform 1.