GLEPP1 (PTPRO) (NM_030668) Human Untagged Clone

CAT#: SC313211

PTPRO (untagged)-Human protein tyrosine phosphatase, receptor type, O (PTPRO), transcript variant 4


  "NM_030668" in other vectors (4)

Reconstitution Protocol

USD 650.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PTPRO"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PTPRO
Synonyms GLEPP1; NPHS6; PTP-OC; PTP-U2; PTPROT; PTPU2; R-PTP-O
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_030668, the custom clone sequence may differ by one or more nucleotides


ATGGTTACAGAGATGAATCCCAATGTGGTAGTGATCTCCGTGCTGGCCATCCTTAGCACACTTTTAATTG
GACTGTTGCTTGTTACCCTCATTATTCTTAGGAAAAAGCATCTGCAGATGGCTAGGGAGTGTGGAGCTGG
TACATTTGTCAATTTTGCATCCTTAGAGAGGGATGGAAAGCTTCCATACAACTGGAGTAAAAATGGTTTA
AAGAAGAGGAAACTGACAAACCCGGTTCAACTGGATGACTTTGATGCCTATATTAAGGATATGGCCAAAG
ACTCTGACTATAAATTTTCTCTTCAGTTTGAGGAGTTGAAATTGATTGGACTGGATATCCCACACTTTGC
TGCAGATCTTCCACTGAATCGATGTAAAAACCGTTACACAAACATCCTACCATATGACTTCAGCCGTGTG
AGATTAGTCTCCATGAATGAAGAGGAAGGTGCAGACTACATCAATGCCAACTATATTCCTGGATACAACT
CACCCCAGGAGTATATTGCCACCCAGGGGCCACTGCCTGAAACCAGAAATGACTTCTGGAAGATGGTCCT
GCAACAAAAGTCTCAGATTATTGTCATGCTCACTCAGTGTAATGAGAAAAGGAGGGTGAAATGTGACCAT
TACTGGCCATTCACGGAAGAACCTATAGCCTATGGAGACATCACTGTGGAGATGATTTCAGAGGAAGAGC
AGGACGACTGGGCCTGTAGACACTTCCGGATCAACTATGCTGACGAGATGCAGGATGTGATGCATTTTAA
CTACACTGCATGGCCTGATCATGGTGTGCCCACAGCAAATGCTGCAGAAAGTATCCTGCAGTTTGTACAC
ATGGTCCGACAGCAAGCTACCAAGAGCAAAGGTCCCATGATCATTCACTGCAGTGCTGGCGTGGGACGGA
CAGGAACATTCATTGCCCTGGACAGGCTCTTGCAGCACATTCGGGATCATGAGTTTGTTGACATCTTAGG
GCTGGTGTCAGAAATGAGGTCATACCGGATGTCTATGGTACAGACAGAGGAGCAGTACATTTTTATCCAT
CAGTGTGTGCAACTGATGTGGATGAAGAAGAAGCAGCAGTTCTGCATCAGTGATGTCATATACGAGAATG
TTAGCAAGTCCTAG


Restriction Sites SgfI-MluI     
ACCN NM_030668
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_030668.2, NP_109593.1
RefSeq Size 3886 bp
RefSeq ORF 1134 bp
Locus ID 5800
Cytogenetics 12p13-p12
Domains Y_phosphatase, PTPc_motif
Protein Families Phosphatase, Transmembrane
Gene Summary 'This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]'
Transcript Variant: This variant (4) differs in the 5' UTR and has multiple differences in the coding region but maintains the reading frame, compared to variant 1. Variants 4 and 6 encode the same isoform (d), which is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.