SEMA6D (NM_024966) Human Untagged Clone

CAT#: SC313647

SEMA6D (untagged)-Human sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (SEMA6D), transcript variant 6


  "NM_024966" in other vectors (6)

Reconstitution Protocol

USD 810.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SEMA6D"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SEMA6D
Synonyms FLJ11598; KIAA1479
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_024966, the custom clone sequence may differ by one or more nucleotides


ATGAGGGTCTTCCTGCTTTGTGCCTACATACTGCTGCTGATGGTTTCCCAGTTGAGGGCAGTCAGCTTTC
CTGAAGATGATGAACCCCTTAATACTGTCGACTATCACTATTCAAGGCAATATCCGGTTTTTAGAGGACG
CCCTTCAGGCAATGAATCGCAGCACAGGCTGGACTTTCAGCTGATGTTGAAAATTCGAGACACACTTTAT
ATTGCTGGCAGGGATCAAGTTTATACAGTAAACTTAAATGAAATGCCCAAAACAGAAGTAATACCCAACA
AGAAACTGACATGGCGATCAAGACAACAGGATCGAGAAAACTGTGCTATGAAAGGCAAGCATAAAGATGA
ATGCCACAACTTTATCAAAGTATTTGTTCCAAGAAACGATGAGATGGTTTTTGTTTGTGGTACCAATGCA
TTCAATCCCATGTGTAGATACTACAGGTTGAGTACCTTAGAATATGATGGGGAAGAAATTAGTGGCCTGG
CAAGATGCCCATTTGATGCCAGACAAACCAATGTTGCCCTCTTTGCTGATGGGAAGCTGTATTCTGCCAC
AGTGGCTGACTTCTTGGCCAGCGATGCCGTTATTTATCGAAGCATGGGTGATGGATCTGCCCTTCGCACA
ATAAAATATGATTCCAAATGGATAAAAGAGCCACACTTTCTTCATGCCATAGAATATGGAAACTATGTCT
ATTTCTTCTTTCGAGAAATCGCTGTCGAACATAATAATTTAGGCAAGGCTGTGTATTCCCGCGTGGCCCG
CATATGTAAAAACGACATGGGTGGTTCCCAGCGGGTCCTGGAGAAACACTGGACTTCATTTCTAAAGGCT
CGGCTGAACTGTTCTGTCCCTGGAGATTCGTTTTTCTACTTTGATGTTCTGCAGTCTATTACAGACATAA
TACAAATCAATGGCATCCCCACTGTGGTCGGGGTGTTTACCACGCAGCTCAATAGCATCCCTGGTTCTGC
TGTCTGTGCATTTAGCATGGATGACATTGAAAAAGTATTCAAAGGACGGTTTAAGGAACAGAAAACTCCA
GATTCTGTTTGGACAGCAGTTCCCGAAGACAAAGTGCCAAAGCCAAGGCCTGGCTGTTGTGCAAAACACG
GCCTTGCCGAAGCTTATAAAACCTCCATCGATTTCCCGGATGAAACTCTGTCATTCATCAAATCTCATCC
CCTGATGGACTCTGCCGTTCCACCCATTGCCGATGAGCCCTGGTTCACAAAGACTCGGGTCAGGTACAGA
CTGACGGCCATCTCAGTGGACCATTCAGCCGGACCCTACCAGAACTACACAGTCATCTTTGTTGGCTCTG
AAGCTGGCATGGTACTTAAAGTTCTGGCAAAGACCAGTCCTTTCTCTTTGAACGACAGCGTATTACTGGA
AGAGATTGAAGCCTACAACCATGCAAAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_024966
ORF Size 1431 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_024966.2, NP_079242.2
RefSeq Size 2290
RefSeq ORF 1431
Locus ID 80031
Domains Sema
Protein Families Druggable Genome, Transmembrane
Protein Pathways Axon guidance
Gene Summary Semaphorins are a large family, including both secreted and membrane associated proteins, many of which have been implicated as inhibitors or chemorepellents in axon pathfinding, fasciculation and branching, and target selection. All semaphorins possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Additional sequence motifs C-terminal to the semaphorin domain allow classification into distinct subfamilies. Results demonstrate that transmembrane semaphorins, like the secreted ones, can act as repulsive axon guidance cues. This gene encodes a class 6 vertebrate transmembrane semaphorin that demonstrates alternative splicing. Several transcript variants have been identified and expression of the distinct encoded isoforms is thought to be regulated in a tissue- and development-dependent manner. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (6) represents the shortest transcript and encodes the shortest isoform (6). Lacking a PSI domain and a predicted transmembrane domain, isoform 6 is considered a putative secreted protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.