SEMA6D (NM_024966) Human Untagged Clone
CAT#: SC313647
SEMA6D (untagged)-Human sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (SEMA6D), transcript variant 6
"NM_024966" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SEMA6D |
Synonyms | FLJ11598; KIAA1479 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_024966, the custom clone sequence may differ by one or more nucleotides
ATGAGGGTCTTCCTGCTTTGTGCCTACATACTGCTGCTGATGGTTTCCCAGTTGAGGGCAGTCAGCTTTC CTGAAGATGATGAACCCCTTAATACTGTCGACTATCACTATTCAAGGCAATATCCGGTTTTTAGAGGACG CCCTTCAGGCAATGAATCGCAGCACAGGCTGGACTTTCAGCTGATGTTGAAAATTCGAGACACACTTTAT ATTGCTGGCAGGGATCAAGTTTATACAGTAAACTTAAATGAAATGCCCAAAACAGAAGTAATACCCAACA AGAAACTGACATGGCGATCAAGACAACAGGATCGAGAAAACTGTGCTATGAAAGGCAAGCATAAAGATGA ATGCCACAACTTTATCAAAGTATTTGTTCCAAGAAACGATGAGATGGTTTTTGTTTGTGGTACCAATGCA TTCAATCCCATGTGTAGATACTACAGGTTGAGTACCTTAGAATATGATGGGGAAGAAATTAGTGGCCTGG CAAGATGCCCATTTGATGCCAGACAAACCAATGTTGCCCTCTTTGCTGATGGGAAGCTGTATTCTGCCAC AGTGGCTGACTTCTTGGCCAGCGATGCCGTTATTTATCGAAGCATGGGTGATGGATCTGCCCTTCGCACA ATAAAATATGATTCCAAATGGATAAAAGAGCCACACTTTCTTCATGCCATAGAATATGGAAACTATGTCT ATTTCTTCTTTCGAGAAATCGCTGTCGAACATAATAATTTAGGCAAGGCTGTGTATTCCCGCGTGGCCCG CATATGTAAAAACGACATGGGTGGTTCCCAGCGGGTCCTGGAGAAACACTGGACTTCATTTCTAAAGGCT CGGCTGAACTGTTCTGTCCCTGGAGATTCGTTTTTCTACTTTGATGTTCTGCAGTCTATTACAGACATAA TACAAATCAATGGCATCCCCACTGTGGTCGGGGTGTTTACCACGCAGCTCAATAGCATCCCTGGTTCTGC TGTCTGTGCATTTAGCATGGATGACATTGAAAAAGTATTCAAAGGACGGTTTAAGGAACAGAAAACTCCA GATTCTGTTTGGACAGCAGTTCCCGAAGACAAAGTGCCAAAGCCAAGGCCTGGCTGTTGTGCAAAACACG GCCTTGCCGAAGCTTATAAAACCTCCATCGATTTCCCGGATGAAACTCTGTCATTCATCAAATCTCATCC CCTGATGGACTCTGCCGTTCCACCCATTGCCGATGAGCCCTGGTTCACAAAGACTCGGGTCAGGTACAGA CTGACGGCCATCTCAGTGGACCATTCAGCCGGACCCTACCAGAACTACACAGTCATCTTTGTTGGCTCTG AAGCTGGCATGGTACTTAAAGTTCTGGCAAAGACCAGTCCTTTCTCTTTGAACGACAGCGTATTACTGGA AGAGATTGAAGCCTACAACCATGCAAAGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_024966 |
ORF Size | 1431 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_024966.2, NP_079242.2 |
RefSeq Size | 2290 |
RefSeq ORF | 1431 |
Locus ID | 80031 |
Domains | Sema |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Axon guidance |
Gene Summary | Semaphorins are a large family, including both secreted and membrane associated proteins, many of which have been implicated as inhibitors or chemorepellents in axon pathfinding, fasciculation and branching, and target selection. All semaphorins possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Additional sequence motifs C-terminal to the semaphorin domain allow classification into distinct subfamilies. Results demonstrate that transmembrane semaphorins, like the secreted ones, can act as repulsive axon guidance cues. This gene encodes a class 6 vertebrate transmembrane semaphorin that demonstrates alternative splicing. Several transcript variants have been identified and expression of the distinct encoded isoforms is thought to be regulated in a tissue- and development-dependent manner. [provided by RefSeq, Nov 2010] Transcript Variant: This variant (6) represents the shortest transcript and encodes the shortest isoform (6). Lacking a PSI domain and a predicted transmembrane domain, isoform 6 is considered a putative secreted protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214172 | SEMA6D (Myc-DDK-tagged)-Human sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (SEMA6D), transcript variant 6 |
USD 420.00 |
|
RG214172 | SEMA6D (GFP-tagged) - Human sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (SEMA6D), transcript variant 6 |
USD 460.00 |
|
RC214172L1 | Lenti ORF clone of Human sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (SEMA6D), transcript variant 6, Myc-DDK-tagged |
USD 768.00 |
|
RC214172L2 | Lenti ORF clone of Human sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (SEMA6D), transcript variant 6, mGFP tagged |
USD 620.00 |
|
RC214172L3 | Lenti ORF clone of Human sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (SEMA6D), transcript variant 6, Myc-DDK-tagged |
USD 620.00 |
|
RC214172L4 | Lenti ORF clone of Human sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (SEMA6D), transcript variant 6, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review