PVRL1 (NECTIN1) (NM_203285) Human Untagged Clone

CAT#: SC313808

PVRL1 (untagged)-Human poliovirus receptor-related 1 (herpesvirus entry mediator C) (PVRL1), transcript variant 2


  "NM_203285" in other vectors (4)

Reconstitution Protocol

USD 770.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NECTIN1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NECTIN1
Synonyms CD111; CLPED1; ED4; HIgR; HV1S; HVEC; nectin-1; OFC7; PRR; PRR1; PVRL1; PVRR; PVRR1; SK-12
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_203285, the custom clone sequence may differ by one or more nucleotides
ATGGCTCGGATGGGGCTTGCGGGCGCCGCTGGACGCTGGTGGGGACTCGCTCTCGGCTTG
ACCGCATTCTTCCTCCCAGGCGTCCACTCCCAGGTGGTCCAGGTGAACGACTCCATGTAT
GGCTTCATCGGCACAGACGTGGTTCTGCACTGCAGCTTTGCCAACCCGCTTCCCAGCGTG
AAGATCACCCAGGTCACATGGCAGAAGTCCACCAATGGCTCCAAGCAGAACGTGGCCATC
TACAACCCATCCATGGGCGTGTCCGTGCTGGCTCCCTACCGCGAGCGTGTGGAATTCCTG
CGGCCCTCCTTCACCGATGGCACTATCCGCCTCTCCCGCCTGGAGCTGGAGGATGAGGGT
GTCTACATCTGCGAGTTTGCTACCTTCCCTACGGGCAATCGAGAAAGCCAGCTCAATCTC
ACGGTGATGGCCAAACCCACCAATTGGATAGAGGGTACCCAGGCAGTGCTTCGAGCCAAG
AAGGGGCAGGATGACAAGGTCCTGGTGGCCACCTGCACCTCAGCCAATGGGAAGCCTCCC
AGTGTGGTATCCTGGGAAACTCGGTTAAAAGGTGAGGCAGAGTACCAGGAGATCCGGAAC
CCCAATGGCACAGTGACGGTCATCAGCCGCTACCGCCTGGTGCCCAGCAGGGAAGCCCAC
CAGCAGTCCTTGGCCTGCATCGTCAACTACCACATGGACCGCTTCAAGGAAAGCCTCACT
CTCAACGTGCAGTATGAGCCTGAGGTAACCATTGAGGGGTTTGATGGCAACTGGTACCTG
CAGCGGATGGACGTGAAGCTCACCTGCAAAGCTGATGCTAACCCCCCAGCCACTGAGTAC
CACTGGACCACGCTAAATGGCTCTCTCCCCAAGGGTGTGGAGGCCCAGAACAGAACCCTC
TTCTTCAAGGGACCCATCAACTACAGCCTGGCAGGGACCTACATCTGTGAGGCCACCAAC
CCCATCGGTACACGCTCAGGCCAGGTGGAGGTCAATATCACAGAAAAGCCCCGCCCCCAG
AGGGGTCTGGGAAGTGCAGCCAGGCTCCTGGCGGGCACCGTGGCCGTGTTCCTCATCCTA
GTTGCTGTGCTCACTGTCTTCTTCCTGTACAACCGGCAGCAGAAGAGCCCACCGGAGACG
GATGGGGCCGGGACCGACCAGCCCCTCTCCCAGAAGCCGGAGCCTTCTCCCAGCAGGCAA
AGCTCCCTTGTGCCTGAGGATATCCAGGTTGTCCACCTGGACCCAGGGAGGCAGCAGCAG
CAAGAAGAGGAGGACTTGCAGAAGCTGTCCCTGCAGCCCCCCTACTATGATCTGGGGGTC
TCCCCCTCCTACCACCCCTCGGTAAGGACAACCGAACCTCGAGGAGAGTGCCCC
Restriction Sites Please inquire     
ACCN NM_203285
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_203285.1, NP_976030.1
RefSeq Size 1549 bp
RefSeq ORF 1377 bp
Locus ID 5818
Cytogenetics 11q23.3
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Protein Pathways Adherens junction, Cell adhesion molecules (CAMs)
Gene Summary 'This gene encodes an adhesion protein that plays a role in the organization of adherens junctions and tight junctions in epithelial and endothelial cells. The protein is a calcium(2+)-independent cell-cell adhesion molecule that belongs to the immunoglobulin superfamily and has 3 extracellular immunoglobulin-like loops, a single transmembrane domain (in some isoforms), and a cytoplasmic region. This protein acts as a receptor for glycoprotein D (gD) of herpes simplex viruses 1 and 2 (HSV-1, HSV-2), and pseudorabies virus (PRV) and mediates viral entry into epithelial and neuronal cells. Mutations in this gene cause cleft lip and palate/ectodermal dysplasia 1 syndrome (CLPED1) as well as non-syndromic cleft lip with or without cleft palate (CL/P). Alternative splicing results in multiple transcript variants encoding proteins with distinct C-termini. [provided by RefSeq, Oct 2009]'
Transcript Variant: This variant (2) uses alternate exons for its 3' end, compared to variant 1, resulting in a protein (isoform 2; also known as isoform Alpha, beta, or HIgR) with a shorter and distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.