Eph receptor A3 (EPHA3) (NM_182644) Human Untagged Clone

CAT#: SC313919

EPHA3 (untagged)-Human EPH receptor A3 (EPHA3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EPHA3
• Synonyms: EK4; ETK; ETK1; HEK; HEK4; TYRO4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_182644, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATTGTCAGCTCTCCATCCTCCTCCTTCTCAGCTGCTCTGTTCTCGACAGCTTCGGGGAACTGATTC
  CGCAGCCTTCCAATGAAGTCAATCTACTGGATTCAAAAACAATTCAAGGGGAGCTGGGCTGGATCTCTTA
  TCCATCACATGGGTGGGAAGAGATCAGTGGTGTGGATGAACATTACACACCCATCAGGACTTACCAGGTG
  TGCAATGTCATGGACCACAGTCAAAACAATTGGCTGAGAACAAACTGGGTCCCCAGGAACTCAGCTCAGA
  AGATTTATGTGGAGCTCAAGTTCACTCTACGAGACTGCAATAGCATTCCATTGGTTTTAGGAACTTGCAA
  GGAGACATTCAACCTGTACTACATGGAGTCTGATGATGATCATGGGGTGAAATTTCGAGAGCATCAGTTT
  ACAAAGATTGACACCATTGCAGCTGATGAAAGTTTCACTCAAATGGATCTTGGGGACCGTATTCTGAAGC
  TCAACACTGAGATTAGAGAAGTAGGTCCTGTCAACAAGAAGGGATTTTATTTGGCATTTCAAGATGTTGG
  TGCTTGTGTTGCCTTGGTGTCTGTGAGAGTATACTTCAAAAAGTGCCCATTTACAGTGAAGAATCTGGCT
  ATGTTTCCAGACACGGTACCCATGGACTCCCAGTCCCTGGTGGAGGTTAGAGGGTCTTGTGTCAACAATT
  CTAAGGAGGAAGATCCTCCAAGGATGTACTGCAGTACAGAAGGCGAATGGCTTGTACCCATTGGCAAGTG
  TTCCTGCAATGCTGGCTATGAAGAAAGAGGTTTTATGTGCCAAGCTTGTCGACCAGGTTTCTACAAGGCA
  TTGGATGGTAATATGAAGTGTGCTAAGTGCCCGCCTCACAGTTCTACTCAGGAAGATGGTTCAATGAACT
  GCAGGTGTGAGAATAATTACTTCCGGGCAGACAAAGACCCTCCATCCATGGCTTGTACCCGACCTCCATC
  TTCACCAAGAAATGTTATCTCTAATATAAACGAGACCTCAGTTATCCTGGACTGGAGTTGGCCCCTGGAC
  ACAGGAGGCCGGAAAGATGTTACCTTCAACATCATATGTAAAAAATGTGGGTGGAATATAAAACAGTGTG
  AGCCATGCAGCCCAAATGTCCGCTTCCTCCCTCGACAGTTTGGACTCACCAACACCACGGTGACAGTGAC
  AGACCTTCTGGCACATACTAACTACACCTTTGAGATTGATGCCGTTAATGGGGTGTCAGAGCTGAGCTCC
  CCACCAAGACAGTTTGCTGCGGTCAGCATCACAACTAATCAGGCTGCTCCATCACCTGTCCTGACGATTA
  AGAAAGATCGGACCTCCAGAAATAGCATCTCTTTGTCCTGGCAAGAACCTGAACATCCTAATGGGATCAT
  ATTGGACTACGAGGTCAAATACTATGAAAAGCAGGAACAAGAAACAAGTTATACCATTCTGAGGGCAAGA
  GGCACAAATGTTACCATCAGTAGCCTCAAGCCTGACACTATATACGTATTCCAAATCCGAGCCCGAACAG
  CCGCTGGATATGGGACGAACAGCCGCAAGTTTGAGTTTGAAACTAGTCCAGACTGTATGTATTATTTCAA
  TGCAGTCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_182644
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_182644.2, NP_872585.1
• RefSeq Size: 2684 bp
• RefSeq ORF: 1620 bp
• Locus ID: 2042
• Cytogenetics: 3p11.1
• Protein Families: Druggable Genome, Protein Kinase, Secreted Protein, Transmembrane
• Protein Pathways: Axon guidance
• Gene Summary: 'This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1, that results in missing several 3' exons. It encodes isoform b which has a shorter and distinct C-terminus compared to isoform a. This isoform lacks a transmembrane domain and may be a secreted form of the Epha3 receptor.